WormBase Tree Display for Variation: WBVar00145191
expand all nodes | collapse all nodes | view schema
WBVar00145191 | Evidence | Paper_evidence | WBPaper00027624 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ep271 | |||||
Other_name | M01D7.7b.1:c.576G>A | ||||||
M01D7.7a.1:c.732G>A | |||||||
M01D7.7c.1:c.3G>A | |||||||
CE30556:p.Met192Ile | |||||||
CE49743:p.Met1? | |||||||
CE12272:p.Met244Ile | |||||||
HGVSg | CHROMOSOME_I:g.1840103G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | M01D7 | |||
Flanking_sequences | aaactagaaatcaatcttgcagaaccgaat | gaagaatcgaaagctctgttccgaacgatc | |||||
Mapping_target | M01D7 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00027624 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004782 | ||||||
Laboratory | CE | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001196 | |||||
Transcript | M01D7.7b.1 (12) | ||||||
M01D7.7a.1 (12) | |||||||
M01D7.7c.1 (12) | |||||||
Interactor | WBInteraction000542425 | ||||||
WBInteraction000542429 | |||||||
WBInteraction000542433 | |||||||
WBInteraction000542437 | |||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00027624 | |||
Genetics | Interpolated_map_position | I | -12.5484 | ||||
Description | Phenotype (19) | ||||||
Reference | WBPaper00043908 | ||||||
WBPaper00027624 | |||||||
WBPaper00050796 | |||||||
Remark | ep217 is most likely a "g" to "a" substitution | ||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001196 Missense 244 M to I | Paper_evidence | WBPaper00027624 | |||||
Method | Substitution_allele |