WormBase Tree Display for Variation: WBVar00145133
expand all nodes | collapse all nodes | view schema
| WBVar00145133 | Evidence | Paper_evidence | WBPaper00027659 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | en9 | |||||||
| Other_name | C02C6.1a.1:c.1201A>T | ||||||||
| CE07833:p.Ile401Phe | |||||||||
| CE07832:p.Ile401Phe | |||||||||
| C02C6.1b.1:c.1201A>T | |||||||||
| HGVSg | CHROMOSOME_X:g.15570412A>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C02C6 | |||||
| Flanking_sequences | atccagtatgccatcagaaacattcacggt | tccgcgtcggtctcttcactccggatatgg | |||||||
| Mapping_target | C02C6 | ||||||||
| Type_of_mutation | Substitution | a | t | Paper_evidence | WBPaper00027659 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | ZH | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001130 | |||||||
| Transcript | C02C6.1b.1 (12) | ||||||||
| C02C6.1a.1 (12) | |||||||||
| Genetics | Interpolated_map_position | X | 22.8508 | ||||||
| Description | Phenotype | WBPhenotype:0002486 | Paper_evidence | WBPaper00050421 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "By contrast, in 62% of dyn-1 mutant embryos, all lobes persisted (Fig. 5f,g and Supplementary Table 2), and FRAP experiments revealed that persistent lobes remained connected to the cell body (16/16 embryos; Fig. 5j). YFP-DYN-1 expressed in endoderm accumulated at lobe necks and rescued the persistent lobe defects of dyn-1mutants (3/39 embryos had persistent lobes, versus 25/30 dyn-1 mutant siblings), consistent with a local requirement for lobe scission (Fig. 5h,i)." | Paper_evidence | WBPaper00050421 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Penetrance | Incomplete | 62 | Paper_evidence | WBPaper00050421 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Rescued_by_transgene | WBTransgene00025709 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0004576 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBbt:0004575 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00050421 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_not_observed | WBPhenotype:0001346 | Paper_evidence | WBPaper00050421 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Similarly, YFP-ACT-5 accumulated at lobe necks in dyn-1 mutants, which were examined at a single point during the 3-fold stage (YFP-ACT-5 localized to at least one lobe neck in 7/28 dyn-1 mutant embryos compared with 6/21 rescued dyn-1; dyn-1(C) embryos; Fig. 6c)." | Paper_evidence | WBPaper00050421 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0004576 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBbt:0004575 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00050421 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | xnEx326 [Pend-1::yfp::act-5, pRF4]; YFP-ACT-5END (YFP-tagged endodermally expressed ACT-5 (actin)) | Paper_evidence | WBPaper00050421 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00027659 | ||||||||
| WBPaper00050421 | |||||||||
| Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001130 Missense 401 I to F | Paper_evidence | WBPaper00027659 | ||||||
| Method | Substitution_allele |
