WormBase Tree Display for Variation: WBVar00145128
expand all nodes | collapse all nodes | view schema
WBVar00145128 | Evidence | Paper_evidence | WBPaper00004900 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | eh15 | |||||||
Other_name | F40E10.4.1:c.791_1548del | ||||||||
CE32412:p.Cys264SerfsTer16 | |||||||||
HGVSg | CHROMOSOME_X:g.14675922_14677866del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C26G2 | |||||
Flanking_sequences | gcgaaactgcggaaatttgtccactaccat | ctcctcttatctggaaacaatatctctacc | |||||||
Mapping_target | C26G2 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005267 | ||||||||
WBStrain00034914 | |||||||||
Laboratory | HX | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004854 | |||||||
Transcript | F40E10.4.1 (11) | ||||||||
Interactor (17) | |||||||||
Genetics | Interpolated_map_position | X | 19.7571 | ||||||
Description | Phenotype | WBPhenotype:0000181 | Paper_evidence | WBPaper00031671 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The slt-1 mutant caused the dorsal and sub-ventral NSM processes to be short in 16% and 22% of cases | Paper_evidence | WBPaper00031671 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031671 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00031671 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | zdIs13 [ tph-1p::GFP] | Paper_evidence | WBPaper00031671 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00036484 | |||||||
WBPaper00031828 | |||||||||
WBPaper00040041 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | AVM axons fail to grow ventrally. | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Loss of slt-1 function results in 40% failure of ALM ventral outgrowth. | Paper_evidence | WBPaper00031828 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals exhibit AVM ventral axon guidance defects. These defects can be rescued by exogenous acetylcholine. | Paper_evidence | WBPaper00040041 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004765 | Paper_evidence | WBPaper00040041 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
WBPaper00031828 | |||||||||
WBPaper00040041 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00038152 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Weak defects in HSN ventral migration. | Paper_evidence | WBPaper00038152 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00038152 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001140 | Paper_evidence | WBPaper00050480 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slt-1 mutations had no effect on AQR and PQR migration on their own | Paper_evidence | WBPaper00050480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003927 | PATO:0000460 | Paper_evidence | WBPaper00050480 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004096 | PATO:0000460 | Paper_evidence | WBPaper00050480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001767 | Paper_evidence | WBPaper00032413 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants lack significant defects in the sidedness of DA/DB motor axon projections | Paper_evidence | WBPaper00032413 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00038152 | ||||||||
WBPaper00040041 | |||||||||
WBPaper00031671 | |||||||||
WBPaper00032446 | |||||||||
WBPaper00032413 | |||||||||
WBPaper00031828 | |||||||||
WBPaper00036484 | |||||||||
WBPaper00050480 | |||||||||
Remark | This deletion is coupled with a smaller deletion that deletes nucleotides 28197 to 28294 referring to the clone C26G2 | Paper_evidence | WBPaper00004900 | ||||||
Method | Deletion_allele |