WormBase Tree Display for Variation: WBVar00144974
expand all nodes | collapse all nodes | view schema
| WBVar00144974 | Evidence | Paper_evidence | WBPaper00028462 | ||
|---|---|---|---|---|---|
| Name | Public_name | e2754 | |||
| Sequence_details | SMap | S_parent | Sequence | ZC416 | |
| Flanking_sequences | aatttaaaaaaaggtctgaactattttttt | ggatttgctaccggttgtcgaaaaaggagt | |||
| Mapping_target | ZC416 | ||||
| Type_of_mutation | Deletion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Laboratory | CB | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00006756 | |||
| Genetics | Interpolated_map_position | IV | -3.02859 | ||
| Reference | WBPaper00028462 | ||||
| Remark | Deletion lies upstream of gene | Paper_evidence | WBPaper00028462 | ||
| Curator_confirmed | WBPerson2970 | ||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006756 Genomic_neighbourhood | Paper_evidence | WBPaper00028462 | |||
| Method | Deletion_allele |
