WormBase Tree Display for Variation: WBVar00144905
expand all nodes | collapse all nodes | view schema
WBVar00144905 | Evidence | Paper_evidence | WBPaper00003886 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e2663 | |||||||
Other_name (2) | |||||||||
HGVSg | CHROMOSOME_III:g.11747433G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y41C4A | |||||
Flanking_sequences | aaaaaagtggcaaaaaacaaaaaaattcca | gaattcctgagcatttcggaaaactcgtcg | |||||||
Mapping_target | Y41C4A | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003886 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004639 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003417 | |||||||
Transcript | Y41C4A.14.2 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y41C4A.14.2:c.256-1G>A | ||||||||
Intron_number | 3/8 | ||||||||
Y41C4A.14.1 | VEP_consequence | splice_acceptor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y41C4A.14.1:c.256-1G>A | ||||||||
Intron_number | 4/9 | ||||||||
Interactor | WBInteraction000008923 | ||||||||
WBInteraction000051783 | |||||||||
WBInteraction000051785 | |||||||||
WBInteraction000501814 | |||||||||
WBInteraction000520835 | |||||||||
WBInteraction000521796 | |||||||||
Genetics | Interpolated_map_position | III | 12.0719 | ||||||
Mapping_data | In_multi_point | 4497 | |||||||
Description | Phenotype | WBPhenotype:0000436 | Paper_evidence | WBPaper00005597 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The expression of HUS-1::GFP in the germline was greatly reduced than in control animals and was excluded from the nucleus. This reduction of expression is likely due to degradation, possibly as a result of improper localization, rather than transcriptional regulation, as GFP under the control of the hus-1 promoter (opIs29(pRH04)) was not affected by loss of MRT-2 (data not shown). | Paper_evidence | WBPaper00005597 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000711 | Paper_evidence | WBPaper00003886 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000739 | Paper_evidence | WBPaper00003886 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are sensitive to DNA damage, as assayed by 2-3X increase in level of lethality among progeny of animals subjected to high levels of mut-2 transposon activity. | Paper_evidence | WBPaper00003886 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | mut-2(r459) | Paper_evidence | WBPaper00003886 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000966 | Paper_evidence | WBPaper00003886 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00003886 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals display a weak Him phenotype, producing 0.9 0.6% males (n=25), meaured in F3 broods. | Paper_evidence | WBPaper00003886 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001756 | Paper_evidence | WBPaper00029176 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | UV-C-induced germ cell apoptosis was strongly reduced but not abolished in mrt-2(e2663) mutants. | Paper_evidence | WBPaper00029176 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | Germ cell apoptosis was measured following exposure to 100 joules per square meter UV-C. | Paper_evidence | WBPaper00029176 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001851 | Paper_evidence | WBPaper00027700 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | These mutants are significantly radiosensitive compared with N2 C. elegans. Radiation induced vulval cell loss causes vulval abnormalities (Pvl/ Vul) | Paper_evidence | WBPaper00027700 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00027700 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00027700 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00027700 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 100-400 Gy radiation | Paper_evidence | WBPaper00027700 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed (3) | |||||||||
Reference (13) | |||||||||
Method | Substitution_allele |