WormBase Tree Display for Variation: WBVar00144905
expand all nodes | collapse all nodes | view schema
WBVar00144905 | Evidence | Paper_evidence | WBPaper00003886 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e2663 | ||||||
Other_name | Y41C4A.14.2:c.256-1G>A | |||||||
Y41C4A.14.1:c.256-1G>A | ||||||||
HGVSg | CHROMOSOME_III:g.11747433G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | Y41C4A | ||||
Flanking_sequences | aaaaaagtggcaaaaaacaaaaaaattcca | gaattcctgagcatttcggaaaactcgtcg | ||||||
Mapping_target | Y41C4A | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003886 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004639 | |||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects (3) | ||||||||
Genetics | Interpolated_map_position | III | 12.0719 | |||||
Mapping_data | In_multi_point | 4497 | ||||||
Description | Phenotype (7) | |||||||
Phenotype_not_observed | WBPhenotype:0000275 | Paper_evidence | WBPaper00003886 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Germ line of animals are not significantly hypersensitive to UV light (data not shown) | Paper_evidence | WBPaper00003886 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001760 | Paper_evidence | WBPaper00031945 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No increase in deletion frequency over wild-type was observed for the endogenous qua375 sequence as determined by PCR. At least 24 populations of 5 animals were assayed. | Paper_evidence | WBPaper00031945 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | pkIs2165[pRP1878: hsp-16.41::ATG-(C)23-stops-LacZ unc-119] or pkIs2172 [pRP1889: hsp-16.41::ATG-(monoA)-stops-LacZ unc-119] | Paper_evidence | WBPaper00031945 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001946 | Paper_evidence | WBPaper00031318 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The extent of diphosphorylated activated form of MPK-1 (dpMPK-1) staining and the proportion of pachytene-stage germ cells is similar to wild type. | Paper_evidence | WBPaper00031318 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference (13) | ||||||||
Method | Substitution_allele |