WormBase Tree Display for Variation: WBVar00144905

WBVar00144905 Evidence: Paper_evidence: WBPaper00003886
  Name: Public_name: e2663
    Other_name: Y41C4A.14.2:c.256-1G>A
      Y41C4A.14.1:c.256-1G>A
    HGVSg: CHROMOSOME_III:g.11747433G>A
  Sequence_details: SMap: S_parent: Sequence: Y41C4A
    Flanking_sequences: aaaaaagtggcaaaaaacaaaaaaattcca gaattcctgagcatttcggaaaactcgtcg
    Mapping_target: Y41C4A
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00003886
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004639
    Laboratory: CB
    Status: Live
  Affects (3)
  Genetics: Interpolated_map_position: III 12.0719
    Mapping_data: In_multi_point: 4497
  Description: Phenotype (7)
    Phenotype_not_observed: WBPhenotype:0000275 Paper_evidence: WBPaper00003886
        Curator_confirmed: WBPerson712
        Remark: Germ line of animals are not significantly hypersensitive to UV light (data not shown) Paper_evidence: WBPaper00003886
            Curator_confirmed: WBPerson712
      WBPhenotype:0001760 Paper_evidence: WBPaper00031945
        Curator_confirmed: WBPerson712
        Remark: No increase in deletion frequency over wild-type was observed for the endogenous qua375 sequence as determined by PCR. At least 24 populations of 5 animals were assayed. Paper_evidence: WBPaper00031945
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: pkIs2165[pRP1878: hsp-16.41::ATG-(C)23-stops-LacZ unc-119] or pkIs2172 [pRP1889: hsp-16.41::ATG-(monoA)-stops-LacZ unc-119] Paper_evidence: WBPaper00031945
              Curator_confirmed: WBPerson712
      WBPhenotype:0001946 Paper_evidence: WBPaper00031318
        Curator_confirmed: WBPerson712
        Remark: The extent of diphosphorylated activated form of MPK-1 (dpMPK-1) staining and the proportion of pachytene-stage germ cells is similar to wild type. Paper_evidence: WBPaper00031318
            Curator_confirmed: WBPerson712
  Reference (13)
  Method: Substitution_allele