WormBase Tree Display for Variation: WBVar00144881
expand all nodes | collapse all nodes | view schema
WBVar00144881 | Evidence | Paper_evidence | WBPaper00002188 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | F49E8 | |||
Flanking_sequences | ggtgtttctccactttttgcagtttttttc | aggatgtgcagttggaaaatggctgcagca | |||||
Mapping_target | F49E8 | ||||||
Type_of_mutation | Substitution | gg | aa | Paper_evidence | WBPaper00002188 | ||
Person_evidence | WBPerson8 | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00000996 | |||||
Transcript | F49E8.5.2 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | ||||||
HGVSc | F49E8.5.2:c.253_254delinsAA | ||||||
HGVSp | CE28408:p.Gly85Lys | ||||||
cDNA_position | 294-295 | ||||||
CDS_position | 253-254 | ||||||
Protein_position | 85 | ||||||
Exon_number | 3/6 | ||||||
Codon_change | GGa/AAa | ||||||
Amino_acid_change | G/K | ||||||
F49E8.5.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | ||||||
HGVSc | F49E8.5.1:c.253_254delinsAA | ||||||
HGVSp | CE28408:p.Gly85Lys | ||||||
cDNA_position | 263-264 | ||||||
CDS_position | 253-254 | ||||||
Protein_position | 85 | ||||||
Exon_number | 2/5 | ||||||
Codon_change | GGa/AAa | ||||||
Amino_acid_change | G/K | ||||||
Genetics | Interpolated_map_position | IV | 3.35426 | ||||
Mapping_data | In_multi_point | 2024 | |||||
Description | Phenotype | WBPhenotype:0000052 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | similar to e2562 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00002188 | ||||||
Remark | e2577 comprises the substitution of two adjacent bases. | Paper_evidence | WBPaper00002188 | ||||
Method | Substitution_allele |