WormBase Tree Display for Variation: WBVar00144879
expand all nodes | collapse all nodes | view schema
WBVar00144879 | Evidence | Paper_evidence | WBPaper00004450 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | K04D7 | |||||
Flanking_sequences | tatgccaggtctcgatatggtaccattgta | gaggaagacgttgaggaatgtattattgaa | |||||||
Mapping_target | K04D7 | ||||||||
Type_of_mutation | Substitution | t | g | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001653 | |||||||
Transcript | K04D7.5a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | K04D7.5a.1:c.2916T>G | ||||||||
HGVSp | CE35579:p.Tyr972Ter | ||||||||
cDNA_position | 2919 | ||||||||
CDS_position | 2916 | ||||||||
Protein_position | 972 | ||||||||
Exon_number | 9/16 | ||||||||
Codon_change | taT/taG | ||||||||
Amino_acid_change | Y/* | ||||||||
K04D7.5b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | K04D7.5b.1:c.2916T>G | ||||||||
HGVSp | CE40976:p.Tyr972Ter | ||||||||
cDNA_position | 2916 | ||||||||
CDS_position | 2916 | ||||||||
Protein_position | 972 | ||||||||
Exon_number | 8/15 | ||||||||
Codon_change | taT/taG | ||||||||
Amino_acid_change | Y/* | ||||||||
Interactor | WBInteraction000538597 | ||||||||
WBInteraction000538602 | |||||||||
Genetics | Interpolated_map_position | IV | 4.55972 | ||||||
Mapping_data | In_multi_point | 2785 | |||||||
In_pos_neg_data | 7375 | ||||||||
Description | Phenotype | WBPhenotype:0000688 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | sterile | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000691 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal gonad development | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000699 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | vulva development mostly abnormal | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000774 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | some spermatogenesis, little oogenesis | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000837 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | often failure of division of Z1, Z4 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term (2) | ||||||||
WBPhenotype:0001962 | Paper_evidence | WBPaper00006440 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 9 | Paper_evidence | WBPaper00006440 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 36 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00006440 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0008406 | PATO:0000460 | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | +/Balancer | Paper_evidence | WBPaper00006440 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00006440 | ||||||||
WBPaper00022033 | |||||||||
Method | Substitution_allele |