WormBase Tree Display for Variation: WBVar00144752
expand all nodes | collapse all nodes | view schema
WBVar00144752 | Evidence | Paper_evidence | WBPaper00029148 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e2333 | |||||
Other_name | CE16260:p.Trp593Ter | ||||||
LLC1.1a.1:c.1778delinsA | |||||||
HGVSg | CHROMOSOME_IV:g.14436848delinsT | ||||||
Sequence_details | SMap | S_parent | Sequence | LLC1 | |||
Flanking_sequences | aaaatcgtcagcaatacaaaatcgaagtgt | gaagatcgtaaaatggctcgagaccacct | |||||
Mapping_target | LLC1 | ||||||
Type_of_mutation | Substitution | gg | rr | Paper_evidence | WBPaper00029148 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004559 | ||||||
WBStrain00040924 | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects (2) | |||||||
Genetics | Interpolated_map_position | IV | 11.9592 | ||||
Description (2) | |||||||
Reference | WBPaper00013706 | ||||||
Remark | e2333 is either a W(593) to Amber or W(593) to Ochre | Paper_evidence | WBPaper00029148 | ||||
Person_evidence | WBPerson1742 | ||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006606 Nonsense | |||||||
Method | Substitution_allele |