WormBase Tree Display for Variation: WBVar00144647
expand all nodes | collapse all nodes | view schema
WBVar00144647 | Evidence | Paper_evidence | WBPaper00033464 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e2223 | |||||
Other_name | Y48A6C.3.1:c.19T>A | ||||||
CE19198:p.Cys7Ser | |||||||
HGVSg | CHROMOSOME_III:g.11119181A>T | ||||||
Sequence_details | SMap | S_parent | Sequence | Y48A6C | |||
Flanking_sequences | agcgaaaaaagtccacaatctccacgtgggc | cgcaaaagtgtgagccattttatgttcaaa | |||||
Mapping_target | Y48A6C | ||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (4) | |||||||
Affects | Gene | WBGene00012976 | |||||
WBGene00305760 | |||||||
Transcript | Y48A6C.12 | ||||||
Y48A6C.3.1 (11) | |||||||
Genetics (2) | |||||||
Reference | WBPaper00033464 | ||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |