WormBase Tree Display for Variation: WBVar00144590
expand all nodes | collapse all nodes | view schema
| WBVar00144590 | Evidence | Paper_evidence (2) | |||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e2141 | |||||
| Other_name | F02A9.6.1:c.2920C>T | ||||||
| CE00237:p.Arg974Cys | |||||||
| HGVSg | CHROMOSOME_III:g.9098313C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | F02A9 | |||
| Flanking_sequences | actgctctgatgctagctgttcgtgcacac | gtgtcagactttccgtagtgcttcttcgtg | |||||
| Mapping_target | F02A9 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00038033 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain (50) | |||||||
| Laboratory | CB | ||||||
| AA | |||||||
| SHU | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001609 | |||||
| Transcript | F02A9.6.1 (12) | ||||||
| Interactor (74) | |||||||
| Isolation | Mutagen | EMS | |||||
| Genetics | Interpolated_map_position | III | 0.163959 | ||||
| Mapping_data | In_multi_point | 1508 | |||||
| Description (2) | |||||||
| Reference (23) | |||||||
| Remark | In addition to the curated substitution, e2141 also has an a to g substitution with flanking sequences atcaaaagagcaggatctcgaaaaacgcca & caagtgcagcatcgtctcgcgaaacaaatc | Paper_evidence | WBPaper00038033 | ||||
| Contrary to what was previously thought and published (Kodoyianni et al., 1992 and also in WormBase), e2141 and e2144 do not bear the same sequence change. e2141 actually carries two mutations in exon 8: c2920t and a3610g. | |||||||
| Method | Substitution_allele |
