WormBase Tree Display for Variation: WBVar00144534
expand all nodes | collapse all nodes | view schema
WBVar00144534 | Evidence | Paper_evidence | WBPaper00002121 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e2065 | |||||||
Other_name | CE52672:p.Pro80Leu | ||||||||
CE52664:p.Pro80Leu | |||||||||
Y47D3A.6b.1:c.239C>T | |||||||||
Y47D3A.6a.1:c.239C>T | |||||||||
HGVSg | CHROMOSOME_III:g.11191871G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y47D3A | |||||
Flanking_sequences | caagtaatttcattcaaagctcagttcccc | gtcacatcaaactttgagcaatcctctgca | |||||||
Mapping_target | Y47D3A | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002121 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (3) | |||||||||
Affects | Gene | WBGene00006604 | |||||||
WBGene00305760 | |||||||||
Transcript (3) | |||||||||
Genetics | Interpolated_map_position | III | 6.94324 | ||||||
Description | Phenotype | WBPhenotype:0000687 | Paper_evidence | WBPaper00000922 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | tra-1/+ XX animals are usually fertile females and tra-l/+ XO animals are females or intersexes. Homozygous XX and XO animals are completely feminized. | Paper_evidence | WBPaper00000922 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Dominant | Paper_evidence | WBPaper00000922 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000922 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00000922 | ||||||||
Method | Substitution_allele |