WormBase Tree Display for Variation: WBVar00144524
expand all nodes | collapse all nodes | view schema
WBVar00144524 | Evidence | Paper_evidence | WBPaper00024442 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e2055 | |||||||
Other_name | CE27762:p.Gly565Glu | ||||||||
F55B12.3a.1:c.1700G>A | |||||||||
F55B12.3b.1:c.1694G>A | |||||||||
CE25007:p.Gly567Glu | |||||||||
HGVSg | CHROMOSOME_V:g.13822314G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F55B12 | |||||
Flanking_sequences | TTTGTTCTACTTCTACGATGCTAGCGTGTGCAGTCG | ATCTCGTAACAACACCGAGGAGACCAAAGTTATCCTTCTCGACTTTGATG | |||||||
Mapping_target | F55B12 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004767 | |||||||
Transcript | F55B12.3b.1 (12) | ||||||||
F55B12.3a.1 (12) | |||||||||
Interactor | WBInteraction000052164 | ||||||||
Genetics | Interpolated_map_position | V | 5.62166 | ||||||
Mapping_data | In_multi_point | 3379 | |||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00024442 | |||||
WBPaper00001133 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2021 | |||||||||
Remark | The penetrance of the egg-laying defect in e2055 heterozygotes is cold-sensitive (at 15 C and 20 C). See Table 7 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | At 15 C and 20 C, 56 percent of e2055 heterozygotes are Egl | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Complete | Fully penetrant at 15C or 20C but only partially penetrant at 25C. | Paper_evidence | WBPaper00024442 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Cold_sensitive | 15 | 20 | Paper_evidence | WBPaper00024442 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Paper_evidence | WBPaper00001133 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 15, 20, 25 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | e2055/+ | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000683 | Paper_evidence | WBPaper00024442 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Causes significant masculinization of hermaphrodites. | Paper_evidence | WBPaper00024442 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00024442 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00024442 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001220 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSNs undergo embryonic apoptosis in hermaphrodites | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Dominant | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Cold_sensitive | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001275 | Paper_evidence | WBPaper00024442 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Causes increased lin-12 signaling. | Paper_evidence | WBPaper00024442 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Reference | WBPaper00001105 | ||||||||
WBPaper00001133 | |||||||||
WBPaper00024442 | |||||||||
WBPaper00010313 | |||||||||
Method | Substitution_allele |