WormBase Tree Display for Variation: WBVar00144323
expand all nodes | collapse all nodes | view schema
WBVar00144323 | Evidence | Paper_evidence | WBPaper00031483 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1812 | |||||||
Other_name | B0024.8b.1:c.873+1G>A | ||||||||
B0024.8c.1:c.606+1G>A | |||||||||
B0024.8a.1:c.2649+1G>A | |||||||||
B0024.8d.1:c.600+1G>A | |||||||||
HGVSg | CHROMOSOME_V:g.10301158C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0024 | |||||
Flanking_sequences | aactccaaaattgattcagaaatggaaaag | tacaaaacaaatgtagacttaaaataacaa | |||||||
Mapping_target | B0024 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00031483 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004477 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000491 | |||||||
Transcript | B0024.8d.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0024.8d.1:c.600+1G>A | ||||||||
Intron_number | 6/13 | ||||||||
B0024.8b.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0024.8b.1:c.873+1G>A | ||||||||
Intron_number | 8/15 | ||||||||
B0024.8c.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0024.8c.1:c.606+1G>A | ||||||||
Intron_number | 6/12 | ||||||||
B0024.8a.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0024.8a.1:c.2649+1G>A | ||||||||
Intron_number | 17/24 | ||||||||
Genetics | Interpolated_map_position | V | 2.45535 | ||||||
Mapping_data | In_2_point | 791 | |||||||
In_multi_point | 723 | ||||||||
1173 | |||||||||
3064 | |||||||||
3065 | |||||||||
3066 | |||||||||
Description | Phenotype | WBPhenotype:0000131 | Paper_evidence | WBPaper00049337 | |||||
Person_evidence | WBPerson10260 | ||||||||
Curator_confirmed | WBPerson10260 | ||||||||
WBPerson712 | |||||||||
Remark | Figure 3B and data not shown. | Paper_evidence | WBPaper00049337 | ||||||
Person_evidence | WBPerson10260 | ||||||||
Curator_confirmed | WBPerson10260 | ||||||||
The independently isolated che-12(e1812) mutant also exhibited strong defects in ascaroside-induced dauer formation. | Paper_evidence | WBPaper00049337 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00049337 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005104 | Paper_evidence | WBPaper00049337 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | kyIs128[str-3p::GFP] | Paper_evidence | WBPaper00049337 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000249 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | defective osmotic avoidance | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000260 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | amphid sheath cells fail to secrete matrix material | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Intermediate response to dauer inducing conditions as assayed through SDS resistance of animals from a crowded, starved plate. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000663 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Defective in avoidance of concentrated NaCl. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mating efficiency 3; 10-30% of WT mating efficiency. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000932 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | him-5(e1490) | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001526 | Paper_evidence | WBPaper00049337 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ASK cilia length is significantly shorter in mutants. | Paper_evidence | WBPaper00049337 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00049337 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005668 | PATO:0000460 | Paper_evidence | WBPaper00049337 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | kyIs128[str-3p::GFP] | Paper_evidence | WBPaper00049337 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002053 | Paper_evidence | WBPaper00055368 | |||||||
Curator_confirmed | WBPerson466 | ||||||||
Affected_by | Molecule | WBMol:00002786 | Paper_evidence | WBPaper00055368 | |||||
Curator_confirmed | WBPerson466 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00002087 | |||||||
WBPaper00000932 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Defects in dye filling. | Paper_evidence | WBPaper00002087 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Consistent strong FITC staining of ADF and consistently weak staining of other amphids and phasmids. | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Dyf (weak FITC uptake by amphids and phasmids) | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002087 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No FITC staining of ray sensilla. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000649 | Paper_evidence | WBPaper00003680 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | males are not defective in response or vulva location | Paper_evidence | WBPaper00003680 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Normal response to dilute NaCl gradient. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001438 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001530 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No FITC staining of CEP. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No FITC staining of ADE or PDE. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0004004 | Paper_evidence | WBPaper00003680 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | males are not defective in response or vulva location | Paper_evidence | WBPaper00003680 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00000932 | ||||||||
WBPaper00029016 | |||||||||
WBPaper00006052 | |||||||||
WBPaper00022504 | |||||||||
WBPaper00002087 | |||||||||
WBPaper00001786 | |||||||||
WBPaper00003680 | |||||||||
WBPaper00049337 | |||||||||
WBPaper00055368 | |||||||||
WBPaper00064927 | |||||||||
Method | Substitution_allele |