WormBase Tree Display for Variation: WBVar00144317
expand all nodes | collapse all nodes | view schema
WBVar00144317 | Evidence | Paper_evidence | WBPaper00005786 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1805 | ||||||
Other_name (4) | ||||||||
HGVSg | CHROMOSOME_I:g.10507890G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F59C6 | ||||
Flanking_sequences | gaattttgatgagtttcagaagaatccactc | aaagcgttctccaaagcaatacggatgcaat | ||||||
Mapping_target | F59C6 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00005786 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004474 | |||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000492 | ||||||
Transcript | F59C6.7b.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F59C6.7b.1:c.394C>T | |||||||
HGVSp | CE11472:p.Gln132Ter | |||||||
cDNA_position | 394 | |||||||
CDS_position | 394 | |||||||
Protein_position | 132 | |||||||
Exon_number | 4/6 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
F59C6.7a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F59C6.7a.1:c.655C>T | |||||||
HGVSp | CE31704:p.Gln219Ter | |||||||
cDNA_position | 735 | |||||||
CDS_position | 655 | |||||||
Protein_position | 219 | |||||||
Exon_number | 8/11 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
Interactor | WBInteraction000520976 | |||||||
Genetics | Interpolated_map_position | I | 5.05407 | |||||
Mapping_data (3) | ||||||||
Description | Phenotype (13) | |||||||
Phenotype_not_observed | WBPhenotype:0000315 | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Disease_info | Models_disease | DOID:0060340 | ||||||
Models_disease_in_annotation | WBDOannot00000211 | |||||||
Reference | WBPaper00000932 | |||||||
WBPaper00035071 | ||||||||
WBPaper00028448 | ||||||||
WBPaper00029016 | ||||||||
WBPaper00006052 | ||||||||
WBPaper00002087 | ||||||||
WBPaper00001786 | ||||||||
WBPaper00017262 | ||||||||
WBPaper00016325 | ||||||||
WBPaper00064927 | ||||||||
Method | Substitution_allele |