WormBase Tree Display for Variation: WBVar00144317
expand all nodes | collapse all nodes | view schema
WBVar00144317 | Evidence | Paper_evidence | WBPaper00005786 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1805 | ||||||
Other_name | F59C6.7a.1:c.655C>T | |||||||
F59C6.7b.1:c.394C>T | ||||||||
CE11472:p.Gln132Ter | ||||||||
CE31704:p.Gln219Ter | ||||||||
HGVSg | CHROMOSOME_I:g.10507890G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F59C6 | ||||
Flanking_sequences | gaattttgatgagtttcagaagaatccactc | aaagcgttctccaaagcaatacggatgcaat | ||||||
Mapping_target | F59C6 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00005786 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004474 | |||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000492 | ||||||
Transcript (2) | ||||||||
Interactor | WBInteraction000520976 | |||||||
Genetics | Interpolated_map_position | I | 5.05407 | |||||
Mapping_data | In_2_point | 788 | ||||||
2591 | ||||||||
In_multi_point | 720 | |||||||
3046 | ||||||||
In_pos_neg_data | 8307 | |||||||
8308 | ||||||||
8309 | ||||||||
8310 | ||||||||
Description | Phenotype (13) | |||||||
Phenotype_not_observed | WBPhenotype:0000315 | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Disease_info (2) | ||||||||
Reference | WBPaper00000932 | |||||||
WBPaper00035071 | ||||||||
WBPaper00028448 | ||||||||
WBPaper00029016 | ||||||||
WBPaper00006052 | ||||||||
WBPaper00002087 | ||||||||
WBPaper00001786 | ||||||||
WBPaper00017262 | ||||||||
WBPaper00016325 | ||||||||
WBPaper00064927 | ||||||||
Method | Substitution_allele |