WormBase Tree Display for Variation: WBVar00144281
expand all nodes | collapse all nodes | view schema
WBVar00144281 | Evidence | Paper_evidence | WBPaper00003948 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1752 | ||||||
Other_name | Y41D4B.13a.1:c.459G>A | |||||||
CE28360:p.Trp153Ter | ||||||||
HGVSg | CHROMOSOME_IV:g.1600197G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | Y41D4B | ||||
Flanking_sequences | tttttttccagcaaaaacgaaccaggattg | tgggaggcgagaaacgcgttgggaaccact | ||||||
Mapping_target | Y41D4B | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004459 | |||||||
WBStrain00004482 | ||||||||
WBStrain00027172 | ||||||||
WBStrain00027173 | ||||||||
WBStrain00027276 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects (3) | ||||||||
Genetics | Interpolated_map_position | IV | -16.5924 | |||||
Mapping_data | In_2_point | 645 | ||||||
In_multi_point | 578 | |||||||
2437 | ||||||||
Description | Phenotype | WBPhenotype:0000241 | Paper_evidence | WBPaper00003948 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000243 | Paper_evidence | WBPaper00050421 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson2987 | ||||||||
Remark | killer cells fail to engulf target cells; engulfment group B (ced-2,5,10 : suppress vulvaless phenotype of lin-24, lin-33); extensive maternal rescue | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
persistent corpses in the pharynx of L1 (Supplemental Table 1) | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | |||||||
EQ_annotations (2) | ||||||||
Maternal | With_maternal_effect | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000301 | Paper_evidence | WBPaper00003948 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Distal tip cells did not follow a typical path, resulting in gonad arms that exhibited inappropriate turns, twists, or positions with in the body cavity. | Paper_evidence | WBPaper00003948 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00003948 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000885 | Paper_evidence | WBPaper00001438 | ||||||
WBPaper00038317 | ||||||||
WBPaper00050047 | ||||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPerson712 | ||||||||
WBPerson7492 | ||||||||
Remark | Failure to engulf cell corpses | Paper_evidence | WBPaper00001438 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Persistent cell corpses accumulate. | Paper_evidence | WBPaper00038317 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Midbodies not phagocytosed | Paper_evidence | WBPaper00050047 | ||||||
Curator_confirmed | WBPerson7492 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00001438 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
EQ_annotations (2) | ||||||||
Maternal | ||||||||
WBPhenotype:0001172 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | programmed cell deaths abnormal, dying cells arrest at highly refractile stage; extensive maternal rescue | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Maternal | With_maternal_effect | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000188 | Paper_evidence | WBPaper00003948 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Gonadal arms were as long as those in wild-type animals; germ cells were organized properly as well. | Paper_evidence | WBPaper00003948 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000520 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | no gross phenotype | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Maternal | With_maternal_effect | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001656 | Paper_evidence | WBPaper00003948 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Initiating and maintaining a trajectory is normal. | Paper_evidence | WBPaper00003948 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002486 | Paper_evidence | WBPaper00050421 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Mutations in genes within the ced-1/6/7 pathway (ced-1, ced-7, nrf-5, ttr-52), the ced-2/5/12 pathway (ced-2, ced-5), or both pathways (ced-1;ced-2 and ced-7;ced-5) did not cause PGC lobes to persist in L1 larvae (Supplementary Table 1), indicating that ced-10 functions in PGC lobe scission in a different context than it does in cell corpse engulfment." (PGC = 'primordial germ cell') | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00050421 | |||||
Curator_confirmed | WBPerson2987 | |||||||
EQ_annotations (2) | ||||||||
Phenotype_assay | Treatment | All strains include the xnIs360 or xnSi1 transgenes to visualize PGC membranes. | Paper_evidence | WBPaper00050421 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference (12) | ||||||||
Remark | This substitution allele is coupled with a downstream mutation [G192 to E] | Paper_evidence | WBPaper00003948 | |||||
Method | Substitution_allele |