WormBase Tree Display for Variation: WBVar00144248
expand all nodes | collapse all nodes | view schema
WBVar00144248 | Name | Public_name | e1715 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name (2) | |||||||||
HGVSg | CHROMOSOME_X:g.8469880G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T01B10 | |||||
Flanking_sequences | ggcatttacaacagttttgctataaaacat | tagtcatggtattccaatgcttgggcaagc | |||||||
Mapping_target | T01B10 | ||||||||
Type_of_mutation | Substitution | C | T | Paper_evidence | WBPaper00002482 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003174 | |||||||
Transcript | F16F9.5.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | F16F9.5.1:c.314C>T | ||||||||
HGVSp | CE09444:p.Ser105Phe | ||||||||
cDNA_position | 388 | ||||||||
CDS_position | 314 | ||||||||
Protein_position | 105 | ||||||||
Exon_number | 3/19 | ||||||||
Codon_change | tCt/tTt | ||||||||
Amino_acid_change | S/F | ||||||||
Genetics | Interpolated_map_position | X | 0.0292771 | ||||||
Description | Phenotype | WBPhenotype:0000456 | Paper_evidence | WBPaper00000502 | |||||
WBPaper00040149 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | On average, mec-10 mutant animals respond only to 1-4 touches of 10, whereas wild-type animals respond to 9 touches of 10. | Paper_evidence | WBPaper00040149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00040149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002028 | Paper_evidence | WBPaper00040149 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants have MRCs with a dramatic reduction in peak MRC size compared to wild-type. Touch receptor neuron respond to applied pressure stimulus. Mutations in MEC-10 shifted the reversal potential for MRCs by -40 mV or more. | Paper_evidence | WBPaper00040149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00040149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00040149 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00040149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The distribution of the mechanoreceptor channels along the process of PLM touch receptor neurons is essentially unchanged in mec-10 mutants as assayed by the localization pattern of MEC-4::YFP and anti-MEC-2 antibody staining. | Paper_evidence | WBPaper00040149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (2) | |||||||||
Method | Substitution_allele |