WormBase Tree Display for Variation: WBVar00144145
expand all nodes | collapse all nodes | view schema
WBVar00144145 | Name | Public_name | e1605 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE24843:p.His192Tyr | |||||||
C44B11.3.1:c.574C>T | ||||||||
HGVSg | CHROMOSOME_III:g.3134778G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | C44B11 | ||||
Flanking_sequences | gtagagccatataactcgattttgaccacc | ataccactttggagcactcggattgctcat | ||||||
Mapping_target | C44B11 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00034736 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin (4) | ||||||||
Affects | Gene | WBGene00003175 | ||||||
Transcript | C44B11.3.1 (11) | |||||||
Interactor (4) | ||||||||
Genetics | Interpolated_map_position | III | -7.50415 | |||||
Mapping_data | In_2_point | 496 | ||||||
1607 | ||||||||
4698 | ||||||||
In_multi_point | 425 | |||||||
857 | ||||||||
1626 | ||||||||
1627 | ||||||||
1879 | ||||||||
2039 | ||||||||
2439 | ||||||||
In_pos_neg_data | 6855 | |||||||
Description | Phenotype | WBPhenotype:0000315 | Paper_evidence | WBPaper00001125 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000456 | Paper_evidence | WBPaper00000502 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Stronger Mec than e1607. | Paper_evidence | WBPaper00000502 | |||||
Curator_confirmed | WBPerson712 | |||||||
touch insensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Branch defects scored in PLM neuron. | Paper_evidence | WBPaper00045955 | |||||
Curator_confirmed | WBPerson557 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00045955 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | lethargic | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0004029 | Paper_evidence | WBPaper00064660 | ||||||
Curator_confirmed | WBPerson51549 | |||||||
Phenotype_not_observed | WBPhenotype:0000962 | Paper_evidence | WBPaper00038206 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals did not exhibit reduced fluorescence in GFP-expressing touch receptor neurons (TRNs). | Paper_evidence | WBPaper00038206 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | uIs22(Pmec-3::GFP) | Paper_evidence | WBPaper00038206 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001676 | Paper_evidence | WBPaper00001125 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Touch cell processes have normal numbers of large diameter microtubules compared to processes in control animals. | Paper_evidence | WBPaper00001125 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038206 | |||||||
WBPaper00000502 | ||||||||
WBPaper00001125 | ||||||||
WBPaper00014763 | ||||||||
WBPaper00023028 | ||||||||
WBPaper00034736 | ||||||||
WBPaper00045955 | ||||||||
WBPaper00064660 | ||||||||
Method | Substitution_allele |