WormBase Tree Display for Variation: WBVar00144112
expand all nodes | collapse all nodes | view schema
WBVar00144112 | Evidence | Paper_evidence | WBPaper00027217 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1563 | ||||||
Other_name (2) | ||||||||
HGVSg | CHROMOSOME_V:g.6656049_6656050delinsTC | |||||||
Sequence_details | SMap | S_parent | Sequence | T10H9 | ||||
Flanking_sequences | atgatgatcatcatgtgcgctatcgtcgtc | tcttattatcatcatcgttttatgggctgg | ||||||
Mapping_target | T10H9 | |||||||
Type_of_mutation | Substitution | at | ga | Paper_evidence | WBPaper00027217 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004434 | |||||||
WBStrain00033412 | ||||||||
WBStrain00033414 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004897 | ||||||
Transcript | T10H9.4.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
HGVSc | T10H9.4.1:c.289_290delinsGA | |||||||
HGVSp | CE18252:p.Ile97Asp | |||||||
cDNA_position | 319-320 | |||||||
CDS_position | 289-290 | |||||||
Protein_position | 97 | |||||||
Exon_number | 3/4 | |||||||
Codon_change | ATt/GAt | |||||||
Amino_acid_change | I/D | |||||||
Genetics | Interpolated_map_position | V | 0.132255 | |||||
Mapping_data | In_2_point | 233 | ||||||
234 | ||||||||
Description | Phenotype | WBPhenotype:0002256 | Paper_evidence | WBPaper00041069 | ||||
Curator_confirmed | WBPerson1754 | |||||||
Remark | Blocks the increased sensitivity of unc-17(e245) to selenium induced movement decline | Paper_evidence | WBPaper00041069 | |||||
Curator_confirmed | WBPerson1754 | |||||||
Affected_by | Molecule | WBMol:00001915 | Paper_evidence | WBPaper00041069 | ||||
Curator_confirmed | WBPerson1754 | |||||||
Reference (2) | ||||||||
Method | Substitution_allele |