WormBase Tree Display for Variation: WBVar00144077
expand all nodes | collapse all nodes | view schema
WBVar00144077 | Evidence | Paper_evidence | WBPaper00002018 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1527 | ||||||
Other_name | CE15257:p.Val286Asp | |||||||
ZK154.3.1:c.857T>A | ||||||||
HGVSg | CHROMOSOME_X:g.7775487A>T | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK154 | ||||
Flanking_sequences | gcgtcgaaacattgttgggtcagctcaggg | cagtaatggcacgatactaaaaactaagtt | ||||||
Mapping_target | ZK154 | |||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004466 | |||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003171 | ||||||
Transcript | ZK154.3.1 (11) | |||||||
Genetics | Interpolated_map_position | X | -1.27623 | |||||
Description | Phenotype | WBPhenotype:0000315 | Paper_evidence | WBPaper00000550 | ||||
Curator_confirmed | WBPerson95 | |||||||
Remark | Mutants heterozygous (but not homozygous) for mec-7 alleles e1505, e1343, e1522, and e1527 have a temperature-sensitive Mec phenotype, i.e., they are temperature sensitive dominants. | Paper_evidence | WBPaper00000550 | |||||
Curator_confirmed | WBPerson95 | |||||||
Dominant | Paper_evidence | WBPaper00000550 | ||||||
Curator_confirmed | WBPerson95 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00000550 | |||||
Curator_confirmed | WBPerson95 | |||||||
Phenotype_assay | Genotype | e1527/+ | Paper_evidence | WBPaper00000550 | ||||
Curator_confirmed | WBPerson95 | |||||||
WBPhenotype:0000456 | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Semi_dominant (2) | ||||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Touch neurons lack large specialized microtubules. | Paper_evidence | WBPaper00000502 | |||||
Curator_confirmed | WBPerson712 | |||||||
Semi_dominant (2) | ||||||||
Reference | WBPaper00000502 | |||||||
WBPaper00002018 | ||||||||
WBPaper00013736 | ||||||||
WBPaper00000550 | ||||||||
Remark (2) | ||||||||
Method | Substitution_allele |