WormBase Tree Display for Variation: WBVar00144077
expand all nodes | collapse all nodes | view schema
WBVar00144077 | Evidence | Paper_evidence | WBPaper00002018 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e1527 | |||||
Other_name | CE15257:p.Val286Asp | ||||||
ZK154.3.1:c.857T>A | |||||||
HGVSg | CHROMOSOME_X:g.7775487A>T | ||||||
Sequence_details | SMap | S_parent | Sequence | ZK154 | |||
Flanking_sequences | gcgtcgaaacattgttgggtcagctcaggg | cagtaatggcacgatactaaaaactaagtt | |||||
Mapping_target | ZK154 | ||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004466 | ||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003171 | |||||
Transcript | ZK154.3.1 (11) | ||||||
Genetics | Interpolated_map_position | X | -1.27623 | ||||
Description | Phenotype (3) | ||||||
Reference (4) | |||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |