WormBase Tree Display for Variation: WBVar00144066
expand all nodes | collapse all nodes | view schema
WBVar00144066 | Evidence | Paper_evidence | WBPaper00002482 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e1515 | |||||
Other_name | F16F9.5.1:c.314C>T | ||||||
CE09444:p.Ser105Phe | |||||||
HGVSg | CHROMOSOME_X:g.8469880G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | T01B10 | |||
Flanking_sequences | ggcatttacaacagttttgctataaaacat | tagtcatggtattccaatgcttgggcaagc | |||||
Mapping_target | T01B10 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002482 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (4) | |||||||
Affects | Gene | WBGene00003174 | |||||
Transcript | F16F9.5.1 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | ||||||
HGVSc | F16F9.5.1:c.314C>T | ||||||
HGVSp | CE09444:p.Ser105Phe | ||||||
cDNA_position | 388 | ||||||
CDS_position | 314 | ||||||
Protein_position | 105 | ||||||
Exon_number | 3/19 | ||||||
Codon_change | tCt/tTt | ||||||
Amino_acid_change | S/F | ||||||
Genetics | Interpolated_map_position | X | 0.0292771 | ||||
Mapping_data (2) | |||||||
Description | Phenotype (25) | ||||||
Phenotype_not_observed | WBPhenotype:0000397 | Paper_evidence | WBPaper00061677 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | mec-10 has a normal response to harsh touch | Paper_evidence | WBPaper00061677 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000412 | Paper_evidence | WBPaper00003408 | |||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00040149 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | The distribution of the mechanoreceptor channels along the process of PLM touch receptor neurons is essentially unchanged in mec-10 mutants as assayed by the localization pattern of MEC-4::YFP and anti-MEC-2 antibody staining. | Paper_evidence | WBPaper00040149 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00031965 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals showed no differences in movement on agar compared to wild-type animals. | Paper_evidence | WBPaper00031965 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000663 | Paper_evidence | WBPaper00003408 | |||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0000738 | Paper_evidence | WBPaper00061677 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Of these mutants, only mec-3 showed a significantly lower precipice response frequency than N2 (Figure 1B,C). | Paper_evidence | WBPaper00061677 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001221 | Paper_evidence | WBPaper00003408 | |||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0001700 | Paper_evidence | WBPaper00031965 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals showed no differences in movement in bulk fluids compared to wild-type animals. | Paper_evidence | WBPaper00031965 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00040149 | ||||||
WBPaper00043908 | |||||||
WBPaper00000502 | |||||||
WBPaper00031965 | |||||||
WBPaper00049074 | |||||||
WBPaper00003408 | |||||||
WBPaper00030928 | |||||||
WBPaper00061677 | |||||||
WBPaper00065340 | |||||||
Method | Substitution_allele |