WormBase Tree Display for Variation: WBVar00143986
expand all nodes | collapse all nodes | view schema
WBVar00143986 | Evidence | Paper_evidence | WBPaper00016044 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e1411 | |||||
Other_name | CE27761:p.Pro91Ser | ||||||
F54B11.3b.1:c.271C>T | |||||||
CE28236:p.Pro91Ser | |||||||
F54B11.3a.1:c.271C>T | |||||||
HGVSg | CHROMOSOME_X:g.13585544C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | F54B11 | |||
Flanking_sequences | gatccatccttgccggaccactgggaagtg | caaaccttggtggtactacttcaggatcac | |||||
Mapping_target | F54B11 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003628 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects (3) | |||||||
Genetics | Interpolated_map_position | X | 13.7256 | ||||
Description | Phenotype | WBPhenotype:0000511 | Paper_evidence | WBPaper00045548 | |||
Curator_confirmed | WBPerson24422 | ||||||
Remark | Intermediate nuclear migration defect where 48.7% of nuclei fail to migrate. | Paper_evidence | WBPaper00045548 | ||||
Curator_confirmed | WBPerson24422 | ||||||
Reference (3) | |||||||
Method | Substitution_allele |