WormBase Tree Display for Variation: WBVar00143977
expand all nodes | collapse all nodes | view schema
WBVar00143977 | Evidence | Paper_evidence | WBPaper00001431 | |||||
---|---|---|---|---|---|---|---|---|
Person_evidence | WBPerson267 | |||||||
Name | Public_name | e1402 | ||||||
Other_name | F07A5.7a.1:c.2395C>T | |||||||
CE42754:p.Leu480Phe | ||||||||
F07A5.7a.2:c.2395C>T | ||||||||
F07A5.7b.1:c.1438C>T | ||||||||
CE09197:p.Leu799Phe | ||||||||
HGVSg | CHROMOSOME_I:g.7377793G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F07A5 | ||||
Flanking_sequences | ttcgttatggctcaagacaccgctgatcgt | ttaccgagaagctcaacatccagaagagac | ||||||
Mapping_target | F07A5 | |||||||
Type_of_mutation | Substitution | C | T | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004323 | |||||||
WBStrain00006248 | ||||||||
WBStrain00022568 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006754 | ||||||
Transcript | F07A5.7a.1 (12) | |||||||
F07A5.7a.2 (12) | ||||||||
F07A5.7b.1 (12) | ||||||||
Interactor | WBInteraction000520570 | |||||||
WBInteraction000520572 | ||||||||
WBInteraction000520574 | ||||||||
Isolation | Mutagen | EMS | ||||||
Forward_genetics | standard phenotypic screen | |||||||
Genetics | Interpolated_map_position | I | 2.05446 | |||||
Description | Phenotype | WBPhenotype:0000644 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | moves well at 15C, paralysed at 25C | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00013649 | |||||||
WBPaper00013682 | ||||||||
WBPaper00016086 | ||||||||
WBPaper00016155 | ||||||||
WBPaper00011913 | ||||||||
WBPaper00014106 | ||||||||
WBPaper00018459 | ||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006754 Missense 798 L to F | |||||||
Method | Substitution_allele |