WormBase Tree Display for Variation: WBVar00143952
expand all nodes | collapse all nodes | view schema
WBVar00143952 | Evidence | Paper_evidence | WBPaper00003347 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1375 | ||||||
Other_name | CE26385:p.Met564CysfsTer7 | |||||||
T07A9.6.1:c.1690_1691delinsTGCGTTGACTCAATGCGTTGACTCGTTGAC | ||||||||
HGVSg | CHROMOSOME_IV:g.422294_422295delinsGTCAACGAGTCAACGCATTGAGTCAACGCA | |||||||
Sequence_details | SMap | S_parent | Sequence | T07A9 | ||||
Flanking_sequences | tcgacacggaggcttcaagcgttgactcaa | gaatccaaaatggcgacctgaaccgtgtgc | ||||||
Mapping_target | T07A9 | |||||||
Type_of_mutation (2) | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004234 | |||||||
WBStrain00004311 | ||||||||
WBStrain00030724 | ||||||||
WBStrain00030758 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000913 | ||||||
Transcript | T07A9.6.1 | VEP_consequence | stop_gained,frameshift_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T07A9.6.1:c.1690_1691delinsTGCGTTGACTCAATGCGTTGACTCGTTGAC | |||||||
HGVSp | CE26385:p.Met564CysfsTer7 | |||||||
cDNA_position | 1719-1720 | |||||||
CDS_position | 1690-1691 | |||||||
Protein_position | 564 | |||||||
Exon_number | 5/9 | |||||||
Codon_change | ATg/TGCGTTGACTCAATGCGTTGACTCGTTGACg | |||||||
Amino_acid_change | M/CVDSMR*LVDX | |||||||
Interactor (13) | ||||||||
Genetics | Interpolated_map_position | IV | -26.0122 | |||||
Mapping_data | In_2_point | 443 | ||||||
5713 | ||||||||
In_multi_point | 337 | |||||||
Description | Phenotype (9) | |||||||
Phenotype_not_observed | WBPhenotype:0000013 | Paper_evidence | WBPaper00058674 | |||||
Curator_confirmed | WBPerson712 | |||||||
Image | WBPicture0000014933 | Paper_evidence | WBPaper00058674 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000966 | Paper_evidence | WBPaper00028759 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | germline is immortal at 20 and 25 degrees Celsius | Paper_evidence | WBPaper00028759 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Strains propagated for many generations and checked for sterility | Paper_evidence | WBPaper00028759 | ||||
Curator_confirmed | WBPerson557 | |||||||
Genotype | daf-18(e1375) | Paper_evidence | WBPaper00028759 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001182 | Paper_evidence | WBPaper00003347 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | daf-18(e1375) mutant animals in an age-1(+) background accumulate wild-type amounts of fat. | Paper_evidence | WBPaper00003347 | |||||
Curator_confirmed | WBPerson712 | |||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00003347 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001653 | Paper_evidence | WBPaper00026674 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 3 | Paper_evidence | WBPaper00026674 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00026674 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | FITC uptake is normal. | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | |||||||
Disease_info | Models_disease | DOID:162 | ||||||
Models_disease_in_annotation | WBDOannot00000548 | |||||||
WBDOannot00000563 | ||||||||
Reference (24) | ||||||||
Remark | [190925 pad] Modified the RH flank to remove the deleted sequence "at" as this was causing an off by one error on the Mol details display and a context issue. | Curator_confirmed | WBPerson1983 | |||||
Method | Deletion_and_insertion_allele |