WormBase Tree Display for Variation: WBVar00143952
expand all nodes | collapse all nodes | view schema
WBVar00143952 | Evidence | Paper_evidence | WBPaper00003347 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | T07A9 | |||||
Flanking_sequences | tcgacacggaggcttcaagcgttgactcaa | gaatccaaaatggcgacctgaaccgtgtgc | |||||||
Mapping_target | T07A9 | ||||||||
Type_of_mutation | Insertion | tgcgttgactcaatgcgttgactcgttgac | |||||||
Deletion | at | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004234 | ||||||||
WBStrain00004311 | |||||||||
WBStrain00030724 | |||||||||
WBStrain00030758 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000913 | |||||||
Transcript | T07A9.6.1 | VEP_consequence | stop_gained,frameshift_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T07A9.6.1:c.1690_1691delinsTGCGTTGACTCAATGCGTTGACTCGTTGAC | ||||||||
HGVSp | CE26385:p.Met564CysfsTer7 | ||||||||
cDNA_position | 1719-1720 | ||||||||
CDS_position | 1690-1691 | ||||||||
Protein_position | 564 | ||||||||
Exon_number | 5/9 | ||||||||
Codon_change | ATg/TGCGTTGACTCAATGCGTTGACTCGTTGACg | ||||||||
Amino_acid_change | M/CVDSMR*LVDX | ||||||||
Interactor (13) | |||||||||
Genetics | Interpolated_map_position | IV | -26.0122 | ||||||
Mapping_data | In_2_point | 443 | |||||||
5713 | |||||||||
In_multi_point | 337 | ||||||||
Description | Phenotype | WBPhenotype:0000013 | Paper_evidence | WBPaper00000316 | |||||
WBPaper00000504 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Defective dauer formation; forms some dauer-like larvae when starved. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000038 | Paper_evidence | WBPaper00003347 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Eight percent of daf-18(e1375) animals die as adults with a burst vulva compared to 0% of wild-type. | Paper_evidence | WBPaper00003347 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect (2) | ||||||||
WBPhenotype:0000060 | Paper_evidence | WBPaper00003347 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Eight percent of daf-18(e1375) animals die as adults with a burst vulva compared to 0% of wild-type. | Paper_evidence | WBPaper00003347 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001422 | Paper_evidence | WBPaper00003347 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00003347 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect (2) | ||||||||
WBPhenotype:0000425 | Paper_evidence | WBPaper00029116 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Blocks increase in di-phosphorylated MPK-1 in clr-1(e1745) mutant | Paper_evidence | WBPaper00029116 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
Phenotype_assay | Genotype | clr-1(e1745) | Paper_evidence | WBPaper00029116 | |||||
Curator_confirmed | WBPerson1754 | ||||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00002149 | |||||||
WBPaper00032237 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The average lifespan was decreased compared to control rrf-3(pk1426) animals. | Paper_evidence | WBPaper00032237 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25.5C | Paper_evidence | WBPaper00002149 | |||||
Curator_confirmed | WBPerson712 | ||||||||
20 | Paper_evidence | WBPaper00032237 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | rrf-3(pk1426) | Paper_evidence | WBPaper00032237 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00029116 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Blocks protein degradation in response to treatment with the AGE-1 inhibitor LY-294002 | Paper_evidence | WBPaper00029116 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
Blocks muscle protein degradation in clr-1(e1745) mutants | Paper_evidence | WBPaper00029116 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Affected_by | Molecule | WBMol:00005384 | Paper_evidence | WBPaper00029116 | |||||
Curator_confirmed | WBPerson1754 | ||||||||
Phenotype_assay | Genotype | clr-1(e1745) | Paper_evidence | WBPaper00029116 | |||||
Curator_confirmed | WBPerson1754 | ||||||||
WBPhenotype:0001775 | Paper_evidence | WBPaper00031942 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Unlike wild-type, growth under thermocycling conditions of 10 minute shifts between 12C and 25C, resulted in a shift in life span similar to the life span of animals reared at 18.5C continuously, not towards animals reared at 12C. That is, life span extension afforded by thermocycling animals was eliminated. | Paper_evidence | WBPaper00031942 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were grown in microfuge tubes in 100l S medium (maintained) and incubated in thermocyclers. Worms were transferred into autoclaved, sterile microfuge tubes either every other day or once every 3 days, dependent upon the strain and stage of life of the worms used. Worms were monitored, counted and fed on a daily basis. Animals were shifted every 10 minutes between 12C and 25C. | Paper_evidence | WBPaper00031942 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 12, 12.5, 18.5, 25 | Paper_evidence | WBPaper00031942 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001999 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The integration of signals for attraction to diacetyl (100x dilute) and avoidance from copper (100 millimolar) was impaired in daf-18(e1375) insulin-like signaling pathway mutants, resulting in fewer animals crossing the copper barrier to get to the diacetyl spot than in wild type controls (Figure 1C) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBMol:00002819 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002256 | Paper_evidence | WBPaper00044686 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Increased sensitivity to movement decline in response to selenium exposure. | Paper_evidence | WBPaper00044686 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
Affected_by | Molecule | WBMol:00001915 | Paper_evidence | WBPaper00044686 | |||||
Curator_confirmed | WBPerson1754 | ||||||||
Phenotype_not_observed | WBPhenotype:0000013 | Paper_evidence | WBPaper00058674 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014933 | Paper_evidence | WBPaper00058674 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000966 | Paper_evidence | WBPaper00028759 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | germline is immortal at 20 and 25 degrees Celsius | Paper_evidence | WBPaper00028759 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | Strains propagated for many generations and checked for sterility | Paper_evidence | WBPaper00028759 | |||||
Curator_confirmed | WBPerson557 | ||||||||
Genotype | daf-18(e1375) | Paper_evidence | WBPaper00028759 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001182 | Paper_evidence | WBPaper00003347 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | daf-18(e1375) mutant animals in an age-1(+) background accumulate wild-type amounts of fat. | Paper_evidence | WBPaper00003347 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect (2) | ||||||||
WBPhenotype:0001653 | Paper_evidence | WBPaper00026674 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 3 | Paper_evidence | WBPaper00026674 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00026674 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | FITC uptake is normal. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:162 | |||||||
Models_disease_in_annotation | WBDOannot00000548 | ||||||||
WBDOannot00000563 | |||||||||
Reference (24) | |||||||||
Remark | [190925 pad] Modified the RH flank to remove the deleted sequence "at" as this was causing an off by one error on the Mol details display and a context issue. | Curator_confirmed | WBPerson1983 | ||||||
Method | Deletion_and_insertion_allele |