WormBase Tree Display for Variation: WBVar00143952
expand all nodes | collapse all nodes | view schema
| WBVar00143952 | Evidence | Paper_evidence | WBPaper00003347 | ||
|---|---|---|---|---|---|
| Name | Public_name | e1375 | |||
| Other_name | CE26385:p.Met564CysfsTer7 | ||||
| T07A9.6.1:c.1690_1691delinsTGCGTTGACTCAATGCGTTGACTCGTTGAC | |||||
| HGVSg | CHROMOSOME_IV:g.422294_422295delinsGTCAACGAGTCAACGCATTGAGTCAACGCA | ||||
| Sequence_details | SMap | S_parent | Sequence | T07A9 | |
| Flanking_sequences | tcgacacggaggcttcaagcgttgactcaa | gaatccaaaatggcgacctgaaccgtgtgc | |||
| Mapping_target | T07A9 | ||||
| Type_of_mutation | Insertion | tgcgttgactcaatgcgttgactcgttgac | |||
| Deletion | at | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00004234 | ||||
| WBStrain00004311 | |||||
| WBStrain00030724 | |||||
| WBStrain00030758 | |||||
| Laboratory | CB | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00000913 | |||
| Transcript | T07A9.6.1 | VEP_consequence | stop_gained,frameshift_variant | ||
| VEP_impact | HIGH | ||||
| HGVSc | T07A9.6.1:c.1690_1691delinsTGCGTTGACTCAATGCGTTGACTCGTTGAC | ||||
| HGVSp | CE26385:p.Met564CysfsTer7 | ||||
| cDNA_position | 1719-1720 | ||||
| CDS_position | 1690-1691 | ||||
| Protein_position | 564 | ||||
| Exon_number | 5/9 | ||||
| Codon_change | ATg/TGCGTTGACTCAATGCGTTGACTCGTTGACg | ||||
| Amino_acid_change | M/CVDSMR*LVDX | ||||
| Interactor (13) | |||||
| Genetics | Interpolated_map_position | IV | -26.0122 | ||
| Mapping_data | In_2_point | 443 | |||
| 5713 | |||||
| In_multi_point | 337 | ||||
| Description (2) | |||||
| Disease_info (2) | |||||
| Reference (24) | |||||
| Remark | [190925 pad] Modified the RH flank to remove the deleted sequence "at" as this was causing an off by one error on the Mol details display and a context issue. | Curator_confirmed | WBPerson1983 | ||
| Method | Deletion_and_insertion_allele |
