WormBase Tree Display for Variation: WBVar00143952
expand all nodes | collapse all nodes | view schema
WBVar00143952 | Evidence | Paper_evidence | WBPaper00003347 | ||
---|---|---|---|---|---|
Name | Public_name | e1375 | |||
Other_name | CE26385:p.Met564CysfsTer7 | ||||
T07A9.6.1:c.1690_1691delinsTGCGTTGACTCAATGCGTTGACTCGTTGAC | |||||
HGVSg | CHROMOSOME_IV:g.422294_422295delinsGTCAACGAGTCAACGCATTGAGTCAACGCA | ||||
Sequence_details | SMap | S_parent | Sequence | T07A9 | |
Flanking_sequences | tcgacacggaggcttcaagcgttgactcaa | gaatccaaaatggcgacctgaaccgtgtgc | |||
Mapping_target | T07A9 | ||||
Type_of_mutation | Insertion | tgcgttgactcaatgcgttgactcgttgac | |||
Deletion | at | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00004234 | ||||
WBStrain00004311 | |||||
WBStrain00030724 | |||||
WBStrain00030758 | |||||
Laboratory | CB | ||||
Status | Live | ||||
Affects | Gene | WBGene00000913 | |||
Transcript | T07A9.6.1 | VEP_consequence | stop_gained,frameshift_variant | ||
VEP_impact | HIGH | ||||
HGVSc | T07A9.6.1:c.1690_1691delinsTGCGTTGACTCAATGCGTTGACTCGTTGAC | ||||
HGVSp | CE26385:p.Met564CysfsTer7 | ||||
cDNA_position | 1719-1720 | ||||
CDS_position | 1690-1691 | ||||
Protein_position | 564 | ||||
Exon_number | 5/9 | ||||
Codon_change | ATg/TGCGTTGACTCAATGCGTTGACTCGTTGACg | ||||
Amino_acid_change | M/CVDSMR*LVDX | ||||
Interactor (13) | |||||
Genetics | Interpolated_map_position | IV | -26.0122 | ||
Mapping_data | In_2_point | 443 | |||
5713 | |||||
In_multi_point | 337 | ||||
Description (2) | |||||
Disease_info (2) | |||||
Reference (24) | |||||
Remark | [190925 pad] Modified the RH flank to remove the deleted sequence "at" as this was causing an off by one error on the Mol details display and a context issue. | Curator_confirmed | WBPerson1983 | ||
Method | Deletion_and_insertion_allele |