WormBase Tree Display for Variation: WBVar00143944
expand all nodes | collapse all nodes | view schema
WBVar00143944 | Name | Public_name | e1364 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C05D2.1e.1:c.583_613+181del | ||||||||
C05D2.1c.3:c.127_157+181del | |||||||||
C05D2.1a.1:c.583_613+181del | |||||||||
C05D2.1d.1:c.583_613+181del | |||||||||
C05D2.1c.1:c.127_157+181del | |||||||||
C05D2.1c.2:c.127_157+181del | |||||||||
HGVSg | CHROMOSOME_III:g.5626842_5627053del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C05D2 | |||||
Flanking_sequences | tcgaccaacaattgcaacatgccggatctc | gcgttggggctagaggctagggagaaattg | |||||||
Mapping_target | C05D2 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004308 | ||||||||
WBStrain00004376 | |||||||||
WBStrain00004381 | |||||||||
WBStrain00030681 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00022910 | |||||||
WBGene00000900 | |||||||||
Transcript | C05D2.1e.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C05D2.1e.1:c.583_613+181del | ||||||||
cDNA_position | 590-? | ||||||||
CDS_position | 583-? | ||||||||
Protein_position | 195-? | ||||||||
Intron_number | 6/11 | ||||||||
Exon_number | 6/12 | ||||||||
C05D2.1d.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C05D2.1d.1:c.583_613+181del | ||||||||
cDNA_position | 583-? | ||||||||
CDS_position | 583-? | ||||||||
Protein_position | 195-? | ||||||||
Intron_number | 5/9 | ||||||||
Exon_number | 5/10 | ||||||||
C05D2.1c.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C05D2.1c.1:c.127_157+181del | ||||||||
cDNA_position | 532-? | ||||||||
CDS_position | 127-? | ||||||||
Protein_position | 43-? | ||||||||
Intron_number | 6/12 | ||||||||
Exon_number | 6/13 | ||||||||
C05D2.1c.2 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C05D2.1c.2:c.127_157+181del | ||||||||
cDNA_position | 444-? | ||||||||
CDS_position | 127-? | ||||||||
Protein_position | 43-? | ||||||||
Intron_number | 5/11 | ||||||||
Exon_number | 5/12 | ||||||||
C05D2.11 | VEP_consequence | non_coding_transcript_exon_variant | |||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | ?-110 | ||||||||
Exon_number | 1/1 | ||||||||
C05D2.1c.3 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C05D2.1c.3:c.127_157+181del | ||||||||
cDNA_position | 308-? | ||||||||
CDS_position | 127-? | ||||||||
Protein_position | 43-? | ||||||||
Intron_number | 3/8 | ||||||||
Exon_number | 3/9 | ||||||||
C05D2.1a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C05D2.1a.1:c.583_613+181del | ||||||||
cDNA_position | 583-? | ||||||||
CDS_position | 583-? | ||||||||
Protein_position | 195-? | ||||||||
Intron_number | 5/11 | ||||||||
Exon_number | 5/12 | ||||||||
Interactor | WBInteraction000052154 | ||||||||
WBInteraction000052361 | |||||||||
WBInteraction000052368 | |||||||||
WBInteraction000052447 | |||||||||
WBInteraction000052448 | |||||||||
WBInteraction000500851 | |||||||||
WBInteraction000500861 | |||||||||
WBInteraction000501799 | |||||||||
Genetics | Interpolated_map_position | III | -1.46806 | ||||||
Mapping_data | In_2_point | 276 | |||||||
277 | |||||||||
In_multi_point (6) | |||||||||
In_pos_neg_data | 805 | ||||||||
809 | |||||||||
Description | Phenotype | WBPhenotype:0000012 | Paper_evidence | WBPaper00000316 | |||||
WBPaper00000502 | |||||||||
WBPaper00028386 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Recovered by selection for resistance to 1% SDS. | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals formed less than 10% dauer at 16C. | Paper_evidence | WBPaper00028386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive (2) | |||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00000316 | |||||
WBPaper00000502 | |||||||||
WBPaper00028386 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16 | Paper_evidence | WBPaper00028386 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | unc-4(e120) | Paper_evidence | WBPaper00028386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000229 | Paper_evidence | WBPaper00002374 | |||||||
Curator_confirmed | WBPerson551 | ||||||||
WBPhenotype:0000297 | Paper_evidence | WBPaper00002374 | |||||||
Curator_confirmed | WBPerson551 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00002374 | ||||||
Curator_confirmed | WBPerson551 | ||||||||
WBPhenotype:0001068 | Paper_evidence | WBPaper00000635 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Incomplete | variable | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | 5 mg/ml serotonin | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001183 | Paper_evidence | WBPaper00053184 | |||||||
Curator_confirmed | WBPerson12433 | ||||||||
WBPhenotype:0001340 | Paper_evidence | WBPaper00000635 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Incomplete | variable | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | 0.75 mg/ml imipramine | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Acute CO2 avoidance is reduced | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000706 | Paper_evidence | WBPaper00025094 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutations did not result in Glo phenotypes | Paper_evidence | WBPaper00025094 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Staining with LysoTracker Red and acridine orange | Paper_evidence | WBPaper00025094 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | FITC uptake is normal. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (15) | |||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000900 Coding_exon | Paper_evidence | WBPaper00023888 | ||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00022910 Noncoding_exon Inferred_automatically map_allele.pl | |||||||||
Method | Deletion_allele |