WormBase Tree Display for Variation: WBVar00143936
expand all nodes | collapse all nodes | view schema
WBVar00143936 | Evidence | Paper_evidence | WBPaper00003888 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1348 | |||||||
Other_name | CE18951:p.Gln160Ter | ||||||||
T09A5.10.1:c.478C>T | |||||||||
T09A5.10.2:c.478C>T | |||||||||
HGVSg | CHROMOSOME_II:g.7861183C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | T09A5 | |||||
Flanking_sequences | tgggcatgtcttcggagagatgacgaagat | aggaagcatccagtggcttcaggactccga | |||||||
Mapping_target | T09A5 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004404 | ||||||||
WBStrain00034590 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002994 | |||||||
Transcript (2) | |||||||||
Genetics | Interpolated_map_position | II | 0.586618 | ||||||
Mapping_data | In_multi_point | 50 | |||||||
705 | |||||||||
711 | |||||||||
In_pos_neg_data | 1359 | ||||||||
1391 | |||||||||
1465 | |||||||||
1473 | |||||||||
1480 | |||||||||
1484 | |||||||||
1497 | |||||||||
1505 | |||||||||
1509 | |||||||||
Description | Phenotype (12) | ||||||||
Phenotype_not_observed | WBPhenotype:0000433 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | All postembryonic divisions fail from defective cytokinesis although DNA replication continues. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000517 | Paper_evidence | WBPaper00000008 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The behavior of the mutant at hatching is also indistinguishable from that of the wild type. | Paper_evidence | WBPaper00000008 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00000008 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001028 | Paper_evidence | WBPaper00000008 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The numbers and morphology of nuclei present at hatching in C. elegans appear the same in the wild-type animals and in the mutant. | Paper_evidence | WBPaper00000008 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00000008 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0005634 | PATO:0000460 | Paper_evidence | WBPaper00000008 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (5) | |||||||||
Method | Substitution_allele |