WormBase Tree Display for Variation: WBVar00143932
expand all nodes | collapse all nodes | view schema
| WBVar00143932 | Evidence | Paper_evidence | WBPaper00005591 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e1342 | |||||
| Other_name | W02D3.3.3:c.908_909delinsAA | ||||||
| CE31080:p.Trp303Ter | |||||||
| W02D3.3.1:c.908_909delinsAA | |||||||
| W02D3.3.2:c.908_909delinsAA | |||||||
| HGVSg | CHROMOSOME_I:g.6727021_6727022delinsAA | ||||||
| Sequence_details | SMap | S_parent | Sequence | W02D3 | |||
| Flanking_sequences | ctgctcatccagttattcatgaatctgcat | cattatactcatccagaaaatcaaaatata | |||||
| Mapping_target | W02D3 | ||||||
| Type_of_mutation | Substitution | gg | rr | Paper_evidence | WBPaper00005591 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00004340 | ||||||
| WBStrain00004383 | |||||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003170 | |||||
| Transcript | W02D3.3.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | W02D3.3.1:c.908_909delinsAA | ||||||
| HGVSp | CE31080:p.Trp303Ter | ||||||
| cDNA_position | 911-912 | ||||||
| CDS_position | 908-909 | ||||||
| Protein_position | 303 | ||||||
| Exon_number | 7/9 | ||||||
| Codon_change | tGG/tAA | ||||||
| Amino_acid_change | W/* | ||||||
| W02D3.3.3 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | W02D3.3.3:c.908_909delinsAA | ||||||
| HGVSp | CE31080:p.Trp303Ter | ||||||
| cDNA_position | 984-985 | ||||||
| CDS_position | 908-909 | ||||||
| Protein_position | 303 | ||||||
| Exon_number | 8/10 | ||||||
| Codon_change | tGG/tAA | ||||||
| Amino_acid_change | W/* | ||||||
| W02D3.3.2 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | W02D3.3.2:c.908_909delinsAA | ||||||
| HGVSp | CE31080:p.Trp303Ter | ||||||
| cDNA_position | 991-992 | ||||||
| CDS_position | 908-909 | ||||||
| Protein_position | 303 | ||||||
| Exon_number | 8/10 | ||||||
| Codon_change | tGG/tAA | ||||||
| Amino_acid_change | W/* | ||||||
| Interactor | WBInteraction000519070 | ||||||
| WBInteraction000519086 | |||||||
| WBInteraction000519087 | |||||||
| WBInteraction000571508 | |||||||
| WBInteraction000571510 | |||||||
| WBInteraction000571511 | |||||||
| WBInteraction000571521 | |||||||
| WBInteraction000571563 | |||||||
| Genetics | Interpolated_map_position | I | 1.29964 | ||||
| Mapping_data | In_2_point | 29 | |||||
| In_multi_point | 33 | ||||||
| 420 | |||||||
| 964 | |||||||
| Description | Phenotype (5) | ||||||
| Reference (6) | |||||||
| Remark | e1342 is either a W(303) to opal or W(303) to amber nonsense mutation. | Paper_evidence | WBPaper00005591 | ||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003170 Amber_UAG_or_Opal_UGA W(303) to stop | Paper_evidence | WBPaper00005591 | |||||
| Method | Substitution_allele |
