WormBase Tree Display for Variation: WBVar00143932
expand all nodes | collapse all nodes | view schema
WBVar00143932 | Evidence | Paper_evidence | WBPaper00005591 | |||||
---|---|---|---|---|---|---|---|---|
Name (3) | ||||||||
Sequence_details | SMap | S_parent | Sequence | W02D3 | ||||
Flanking_sequences | ctgctcatccagttattcatgaatctgcat | cattatactcatccagaaaatcaaaatata | ||||||
Mapping_target | W02D3 | |||||||
Type_of_mutation | Substitution | gg | rr | Paper_evidence | WBPaper00005591 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004340 | |||||||
WBStrain00004383 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003170 | ||||||
Transcript | W02D3.3.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | W02D3.3.1:c.908_909delinsAA | |||||||
HGVSp | CE31080:p.Trp303Ter | |||||||
cDNA_position | 911-912 | |||||||
CDS_position | 908-909 | |||||||
Protein_position | 303 | |||||||
Exon_number | 7/9 | |||||||
Codon_change | tGG/tAA | |||||||
Amino_acid_change | W/* | |||||||
W02D3.3.3 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | W02D3.3.3:c.908_909delinsAA | |||||||
HGVSp | CE31080:p.Trp303Ter | |||||||
cDNA_position | 984-985 | |||||||
CDS_position | 908-909 | |||||||
Protein_position | 303 | |||||||
Exon_number | 8/10 | |||||||
Codon_change | tGG/tAA | |||||||
Amino_acid_change | W/* | |||||||
W02D3.3.2 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | W02D3.3.2:c.908_909delinsAA | |||||||
HGVSp | CE31080:p.Trp303Ter | |||||||
cDNA_position | 991-992 | |||||||
CDS_position | 908-909 | |||||||
Protein_position | 303 | |||||||
Exon_number | 8/10 | |||||||
Codon_change | tGG/tAA | |||||||
Amino_acid_change | W/* | |||||||
Interactor | WBInteraction000519070 | |||||||
WBInteraction000519086 | ||||||||
WBInteraction000519087 | ||||||||
WBInteraction000571508 | ||||||||
WBInteraction000571510 | ||||||||
WBInteraction000571511 | ||||||||
WBInteraction000571521 | ||||||||
WBInteraction000571563 | ||||||||
Genetics (2) | ||||||||
Description | Phenotype | WBPhenotype:0000456 | Paper_evidence | WBPaper00000502 | ||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | touch insensitive | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | lethargic | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00030928 | ||||||
Curator_confirmed | WBPerson48753 | |||||||
Remark | DAF-16::GFP nuclear accumulation does not occur as a result of 100G gravitational force as in control worms (Figure 7a) | Paper_evidence | WBPaper00030928 | |||||
Curator_confirmed | WBPerson48753 | |||||||
WBPhenotype:0002592 | Paper_evidence | WBPaper00030928 | ||||||
Curator_confirmed | WBPerson48753 | |||||||
Remark | DAF-16::GFP nuclear accumulation does not occur as a result of 100G gravitational force as in control worms (Figure 7a) | Paper_evidence | WBPaper00030928 | |||||
Curator_confirmed | WBPerson48753 | |||||||
WBPhenotype:0002606 | Paper_evidence | WBPaper00041673 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "To determine the nature of HBx-induced cell death, we introduced the PhspHBx transgenes into animals defective in ced-3, which encodes a caspase essential for apoptosis (21), or animals defectivein mec-6, which is important for necrosis (22). A strong loss-of-function (lf) mutation in ced-3(n2433) or mec-6(e1342) partially suppressed embryonic lethality caused by HBx overexpression (Fig. 1B), indicating that both apoptotic and necrotic cell death contributes to lethality of HBx transgenic embryos." | Paper_evidence | WBPaper00041673 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Figure 2A | Paper_evidence | WBPaper00041673 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00041673 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | [PhspHBx; Psur-5::SUR-5::GFP] | Paper_evidence | WBPaper00041673 | ||||
Curator_confirmed | WBPerson2987 | |||||||
smIs98 [Pmec-3::GFP; Pmec-7::HBx] | Paper_evidence | WBPaper00041673 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00022049 | |||||||
WBPaper00000502 | ||||||||
WBPaper00015299 | ||||||||
WBPaper00011707 | ||||||||
WBPaper00030928 | ||||||||
WBPaper00041673 | ||||||||
Remark | e1342 is either a W(303) to opal or W(303) to amber nonsense mutation. | Paper_evidence | WBPaper00005591 | |||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003170 Amber_UAG_or_Opal_UGA W(303) to stop | Paper_evidence | WBPaper00005591 | ||||||
Method | Substitution_allele |