WormBase Tree Display for Variation: WBVar00143874
expand all nodes | collapse all nodes | view schema
WBVar00143874 | Evidence | Paper_evidence | WBPaper00037788 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e1265 | |||||
Other_name | C52E12.2a.1:c.4489G>A | ||||||
C52E12.2b.1:c.4621G>A | |||||||
CE48050:p.Asp1497Asn | |||||||
C52E12.2a.2:c.4489G>A | |||||||
CE47855:p.Asp1541Asn | |||||||
HGVSg | CHROMOSOME_II:g.7009630G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | C52E12 | |||
Flanking_sequences | ccatatattcttttattccgtgatgatcga | atttggttattcgaggaatcattaatctgg | |||||
Mapping_target | C52E12 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00037788 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (9) | |||||||
Laboratory | CB | ||||||
MTS | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00006831 | |||||
Transcript | C52E12.2a.2 (12) | ||||||
C52E12.2b.1 (12) | |||||||
C52E12.2a.1 (12) | |||||||
Interactor (44) | |||||||
Genetics | Interpolated_map_position | II | 0.260775 | ||||
Mapping_data | In_2_point | 948 | |||||
3709 | |||||||
In_multi_point | 437 | ||||||
1360 | |||||||
1473 | |||||||
1474 | |||||||
1718 | |||||||
2073 | |||||||
2310 | |||||||
2311 | |||||||
In_pos_neg_data | 544 | ||||||
548 | |||||||
554 | |||||||
597 | |||||||
619 | |||||||
4514 | |||||||
Description | Phenotype (34) | ||||||
Phenotype_not_observed (6) | |||||||
Reference (34) | |||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||
Method | Substitution_allele |