WormBase Tree Display for Variation: WBVar00143874
expand all nodes | collapse all nodes | view schema
WBVar00143874 | Evidence | Paper_evidence | WBPaper00037788 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1265 | |||||||
Other_name (5) | |||||||||
HGVSg | CHROMOSOME_II:g.7009630G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C52E12 | |||||
Flanking_sequences | ccatatattcttttattccgtgatgatcga | atttggttattcgaggaatcattaatctgg | |||||||
Mapping_target | C52E12 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00037788 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (9) | |||||||||
Laboratory | CB | ||||||||
MTS | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006831 | |||||||
Transcript | C52E12.2a.2 (12) | ||||||||
C52E12.2b.1 (12) | |||||||||
C52E12.2a.1 (12) | |||||||||
Interactor (44) | |||||||||
Genetics | Interpolated_map_position | II | 0.260775 | ||||||
Mapping_data | In_2_point | 948 | |||||||
3709 | |||||||||
In_multi_point | 437 | ||||||||
1360 | |||||||||
1473 | |||||||||
1474 | |||||||||
1718 | |||||||||
2073 | |||||||||
2310 | |||||||||
2311 | |||||||||
In_pos_neg_data | 544 | ||||||||
548 | |||||||||
554 | |||||||||
597 | |||||||||
619 | |||||||||
4514 | |||||||||
Description | Phenotype (34) | ||||||||
Phenotype_not_observed | WBPhenotype:0000679 | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | PKD-2::GFP localization is not different from wild type. | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000847 | Paper_evidence | WBPaper00032993 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | RSY-1DSR localization to presynaptic sites was not affected in unc-104 mutants, suggesting that RSY-1 is not associated with synaptic vesicles. | Paper_evidence | WBPaper00032993 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000962 | Paper_evidence | WBPaper00039901 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The expression level of odr-3p::GFP in the AWC cell body is not significantly different between wild-type animals and unc-104(e1265) mutants. | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00039901 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | [str-2p::GFP] | Paper_evidence | WBPaper00039901 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||||
WBPaper00039901 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | Asymmetric expression in AWC was normal | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
unc-104(e1265) mutants did not show a 2AWC-ON phenotype. | Paper_evidence | WBPaper00039901 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00039901 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | [str-2p::GFP] | Paper_evidence | WBPaper00039901 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (34) | |||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
Method | Substitution_allele |