WormBase Tree Display for Variation: WBVar00143868
expand all nodes | collapse all nodes | view schema
WBVar00143868 | Evidence | Paper_evidence | WBPaper00004437 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1259 | |||||||
Other_name | e1259tsmat | ||||||||
F22B7.10.1:c.554G>A | |||||||||
CE26462:p.Gly185Asp | |||||||||
HGVSg | CHROMOSOME_III:g.8662194C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F22B7 | |||||
Flanking_sequences | gaactgtagcttcatccattttttatttgg | tgttcttgttaggtgagcgacacaaaaatt | |||||||
Mapping_target | F22B7 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (173) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Linked_to | WBVar02125049 | ||||||||
Affects | Gene | WBGene00001078 | |||||||
Transcript | F22B7.10.1 (12) | ||||||||
Interactor | WBInteraction000052377 | ||||||||
Genetics | Interpolated_map_position | III | -0.191392 | ||||||
Mapping_data | In_2_point | 278 | |||||||
In_multi_point (56) | |||||||||
In_pos_neg_data (5) | |||||||||
Marked_rearrangement | qC1[dpy-19(e1259) glp-1(q339) qIs26] | ||||||||
qC1[dpy-19(e1259) glp-1(q339)] | |||||||||
Description | Phenotype | WBPhenotype:0000469 | Paper_evidence | WBPaper00040419 | |||||
WBPaper00004437 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Abnormal Q and Q daughter migrations. Weaker phenotype if mother dpy-19/+. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
The dpy-19(e1259) mutation results in a loss of QL.pax (QL.paa and QL.pap) neuroblast migration to the posterior of the animal (Figure S3). | Paper_evidence | WBPaper00040419 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"As predicted, we found that in unc-40 and dpy-19 mutants, the QL descendants sometimes migrated anteriorly and the QR descendants sometimes remained in the posterior (Fig. 7 and Hedgecock et al., 1990)." | Paper_evidence | WBPaper00004437 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00040419 | ||||
WBPaper00004437 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004993 | PATO:0000460 | Paper_evidence | WBPaper00040419 | ||||||
WBPaper00004437 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004991 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00004437 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Temperature_sensitive | Heat_sensitive | 20 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Dumpy (20C, 25C); WT (15C); easy to score (ES3) in adult at 25C. Weaker phenotype if mother dpy-19/+. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 20 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score (2) | ||||||||
WBPhenotype:0000648 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mating not successful (ME0) at 25C; but mating successful (ME3) at 15C. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040419 | ||||||||
WBPaper00029020 | |||||||||
WBPaper00001328 | |||||||||
WBPaper00013833 | |||||||||
WBPaper00014840 | |||||||||
WBPaper00004437 | |||||||||
WBPaper00013682 | |||||||||
WBPaper00065007 | |||||||||
Method | Substitution_allele |