WormBase Tree Display for Variation: WBVar00143868
expand all nodes | collapse all nodes | view schema
WBVar00143868 | Evidence | Paper_evidence | WBPaper00004437 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1259 | ||||||
Other_name | e1259tsmat | |||||||
F22B7.10.1:c.554G>A | ||||||||
CE26462:p.Gly185Asp | ||||||||
HGVSg | CHROMOSOME_III:g.8662194C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F22B7 | ||||
Flanking_sequences | gaactgtagcttcatccattttttatttgg | tgttcttgttaggtgagcgacacaaaaatt | ||||||
Mapping_target | F22B7 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (173) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Linked_to | WBVar02125049 | |||||||
Affects | Gene | WBGene00001078 | ||||||
Transcript | F22B7.10.1 (12) | |||||||
Interactor | WBInteraction000052377 | |||||||
Genetics | Interpolated_map_position | III | -0.191392 | |||||
Mapping_data | In_2_point | 278 | ||||||
In_multi_point (56) | ||||||||
In_pos_neg_data | 802 | |||||||
810 | ||||||||
812 | ||||||||
1618 | ||||||||
5742 | ||||||||
Marked_rearrangement | qC1[dpy-19(e1259) glp-1(q339) qIs26] | |||||||
qC1[dpy-19(e1259) glp-1(q339)] | ||||||||
Description | Phenotype | WBPhenotype:0000469 | Paper_evidence | WBPaper00040419 | ||||
WBPaper00004437 | ||||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson2987 | ||||||||
Remark | Abnormal Q and Q daughter migrations. Weaker phenotype if mother dpy-19/+. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
The dpy-19(e1259) mutation results in a loss of QL.pax (QL.paa and QL.pap) neuroblast migration to the posterior of the animal (Figure S3). | Paper_evidence | WBPaper00040419 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
"As predicted, we found that in unc-40 and dpy-19 mutants, the QL descendants sometimes migrated anteriorly and the QR descendants sometimes remained in the posterior (Fig. 7 and Hedgecock et al., 1990)." | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
EQ_annotations (2) | ||||||||
Temperature_sensitive | Heat_sensitive | 20 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000583 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Dumpy (20C, 25C); WT (15C); easy to score (ES3) in adult at 25C. Weaker phenotype if mother dpy-19/+. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 20 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES3_Easy_to_score (2) | |||||||
WBPhenotype:0000648 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mating not successful (ME0) at 25C; but mating successful (ME3) at 15C. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (2) | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00040419 | |||||||
WBPaper00029020 | ||||||||
WBPaper00001328 | ||||||||
WBPaper00013833 | ||||||||
WBPaper00014840 | ||||||||
WBPaper00004437 | ||||||||
WBPaper00013682 | ||||||||
WBPaper00065007 | ||||||||
Method | Substitution_allele |