WormBase Tree Display for Variation: WBVar00143842
expand all nodes | collapse all nodes | view schema
WBVar00143842 | Name | Public_name | e1220 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name (18) | |||||||||
HGVSg | CHROMOSOME_IV:g.7432591G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0496 | |||||
Flanking_sequences | CATCGGGTTGCTCACAGAGATTTAAAATTG | AGAACATTCTTTTAGATCAAAATAATAATG | |||||||
Mapping_target | B0496 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00035423 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004275 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006814 | |||||||
Transcript (10) | |||||||||
Interactor (2) | |||||||||
Genetics | Interpolated_map_position | IV | 3.3349 | ||||||
Description | Phenotype | WBPhenotype:0000509 | Paper_evidence | WBPaper00000536 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Only 2.3% of sperm have pseudopods, some of which are irregular. | Paper_evidence | WBPaper00000536 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006798 | PATO:0000460 | Paper_evidence | WBPaper00000536 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000553 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal reduced muscle birefringence | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slow, good movement | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000782 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | enlarged thick filaments | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000926 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal body muscle ultrastructure | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001046 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | pharyngeal muscle abnormalities weaker than body wall muscle ultrastructure abnormalitites | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0002469 | Paper_evidence | WBPaper00038487 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The probability and size of response to plate taps decreased with continued taps applied with a 10s interval, similar to the response of N2 animals. | Paper_evidence | WBPaper00038487 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004027 | Paper_evidence | WBPaper00038487 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit an escape response (reversal) similar to N2 animals upon an initial plate tap. | Paper_evidence | WBPaper00038487 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00038487 | ||||||||
WBPaper00000536 | |||||||||
WBPaper00015926 | |||||||||
WBPaper00013649 | |||||||||
WBPaper00013853 | |||||||||
WBPaper00012563 | |||||||||
WBPaper00018834 | |||||||||
WBPaper00035423 | |||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006814 Missense 185 E185K | ||||||||
Method | Substitution_allele |