WormBase Tree Display for Variation: WBVar00143839
expand all nodes | collapse all nodes | view schema
WBVar00143839 | Evidence | Paper_evidence | WBPaper00046489 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1216 | |||||||
Other_name (4) | |||||||||
HGVSg | CHROMOSOME_I:g.6764591C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F08B6 | |||||
Flanking_sequences | taacactcgtgtcaagtctgagaaccttca | gtatggaaattttatggtcagatttacttg | |||||||
Mapping_target | F08B6 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00046489 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004273 | ||||||||
WBStrain00006264 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Genetics | Interpolated_map_position | I | 1.31316 | ||||||
Mapping_data | In_pos_neg_data | 5351 | |||||||
6549 | |||||||||
6580 | |||||||||
Description | Phenotype | WBPhenotype:0000349 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | limp paralysed | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000509 | Paper_evidence | WBPaper00000536 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Less than 5% of sperm have pseudopods, all of which have normal morphology. | Paper_evidence | WBPaper00000536 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006798 | PATO:0000460 | Paper_evidence | WBPaper00000536 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000553 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal body muscle birefringence | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | somewhat Egl | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000644 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | limp paralysed | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | very sluggish | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000781 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | thin filaments in small bundles | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000904 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal body muscle ultrastructure | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00000536 | ||||||||
WBPaper00013649 | |||||||||
WBPaper00013682 | |||||||||
WBPaper00046489 | |||||||||
Method | Substitution_allele |