WormBase Tree Display for Variation: WBVar00143838
expand all nodes | collapse all nodes | view schema
WBVar00143838 | Evidence | Paper_evidence | WBPaper00001431 | ||
---|---|---|---|---|---|
Person_evidence | WBPerson267 | ||||
Name | Public_name | e1215 | |||
Other_name | CE42754:p.Gln490Arg | ||||
F07A5.7a.2:c.2426A>G | |||||
F07A5.7b.1:c.1469A>G | |||||
CE09197:p.Gln809Arg | |||||
F07A5.7a.1:c.2426A>G | |||||
HGVSg | CHROMOSOME_I:g.7377762T>C | ||||
Sequence_details | SMap | S_parent | Sequence | F07A5 | |
Flanking_sequences | ttaccgagaagctcaacatccagaagagac | acttgctgagtccgagtccgtaacaatgca | |||
Mapping_target | F07A5 | ||||
Type_of_mutation | Substitution | A | G | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00004272 | ||||
Laboratory | CB | ||||
Status | Live | ||||
Affects | Gene | WBGene00006754 | |||
Transcript | F07A5.7a.1 (12) | ||||
F07A5.7a.2 (12) | |||||
F07A5.7b.1 (12) | |||||
Isolation | Mutagen | EMS | |||
Forward_genetics | standard phenotypic screen | ||||
Genetics | Interpolated_map_position | I | 2.05443 | ||
Reference | WBPaper00013682 | ||||
WBPaper00016086 | |||||
WBPaper00014106 | |||||
WBPaper00018459 | |||||
WBPaper00026300 | |||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006754 Missense 808 Q to R | ||||
Method | Substitution_allele |