WormBase Tree Display for Variation: WBVar00143837
expand all nodes | collapse all nodes | view schema
WBVar00143837 | Evidence | Paper_evidence | WBPaper00001431 | ||
---|---|---|---|---|---|
Person_evidence | WBPerson267 | ||||
Name (3) | |||||
Sequence_details | SMap | S_parent | Sequence | F07A5 | |
Flanking_sequences | gaagtcatcgagttgaccgccactatcgac | agctccagaaggacaaacacaccgctgaga | |||
Mapping_target | F07A5 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00004271 | ||||
Laboratory | CB | ||||
Status | Live | ||||
Affects | Gene | WBGene00006754 | |||
Transcript | F07A5.7a.1 | VEP_consequence | stop_gained | ||
VEP_impact | HIGH | ||||
HGVSc | F07A5.7a.1:c.490C>T | ||||
HGVSp | CE09197:p.Gln164Ter | ||||
cDNA_position | 604 | ||||
CDS_position | 490 | ||||
Protein_position | 164 | ||||
Exon_number | 7/14 | ||||
Codon_change | Cag/Tag | ||||
Amino_acid_change | Q/* | ||||
F07A5.7a.2 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | F07A5.7a.2:c.490C>T | ||||
HGVSp | CE09197:p.Gln164Ter | ||||
cDNA_position | 604 | ||||
CDS_position | 490 | ||||
Protein_position | 164 | ||||
Exon_number | 7/13 | ||||
Codon_change | Cag/Tag | ||||
Amino_acid_change | Q/* | ||||
Interactor | WBInteraction000503483 | ||||
Isolation | Mutagen | EMS | |||
Forward_genetics | standard phenotypic screen | ||||
Genetics | Interpolated_map_position | I | 2.05651 | ||
Mapping_data | In_multi_point | 311 | |||
Description | Phenotype (2) | ||||
Reference (13) | |||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006754 Amber_UAG Q(164) to STOP | ||||
Method | Substitution_allele |