WormBase Tree Display for Variation: WBVar00143837
expand all nodes | collapse all nodes | view schema
WBVar00143837 | Evidence | Paper_evidence | WBPaper00001431 | ||||
---|---|---|---|---|---|---|---|
Person_evidence | WBPerson267 | ||||||
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | F07A5 | |||
Flanking_sequences | gaagtcatcgagttgaccgccactatcgac | agctccagaaggacaaacacaccgctgaga | |||||
Mapping_target | F07A5 | ||||||
Type_of_mutation | Substitution | C | T | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004271 | ||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects (3) | |||||||
Isolation | Mutagen | EMS | |||||
Forward_genetics | standard phenotypic screen | ||||||
Genetics | Interpolated_map_position | I | 2.05651 | ||||
Mapping_data | In_multi_point | 311 | |||||
Description | Phenotype | WBPhenotype:0000349 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | limp paralysed phenotype; more severe phenotype than e73 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000644 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | limp paralysed phenotype, larvae move slightly better; more severe phenotype than e73 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference (13) | |||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006754 Amber_UAG Q(164) to STOP | ||||||
Method | Substitution_allele |