WormBase Tree Display for Variation: WBVar00143821
expand all nodes | collapse all nodes | view schema
WBVar00143821 | Evidence | Paper_evidence | WBPaper00004275 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1196 | ||||||
Other_name | JC8.10b.1:c.2194dup | |||||||
CE28239:p.Asp726GlyfsTer2 | ||||||||
CE29050:p.Asp732GlyfsTer2 | ||||||||
JC8.10a.1:c.2176dup | ||||||||
HGVSg | CHROMOSOME_IV:g.13265305_13265306insC | |||||||
Sequence_details | SMap | S_parent | Sequence | JC8 | ||||
Flanking_sequences | atttcaactatcgaattaatttgtcggggg | atgaagttaagaatgctgttagaaatggag | ||||||
Mapping_target | JC8 | |||||||
Type_of_mutation | Insertion | g | ||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004267 | |||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006763 | ||||||
Transcript (2) | ||||||||
Genetics | Interpolated_map_position | IV | 8.51247 | |||||
Description | Phenotype | WBPhenotype:0000017 | Paper_evidence | WBPaper00004275 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Strong allele. unc-26 mutants are strongly resistant to inhibitors of acetylcholinesterase, indicative of a decrease in acetylcholine release. | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000210 | Paper_evidence | WBPaper00004275 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Strong allele. unc-26 mutants have reduced numbers of enteric muscle contractions, indicative of GABAergic function. | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000229 | Paper_evidence | WBPaper00004275 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals are small. | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000455 | Paper_evidence | WBPaper00004275 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals move backwards with a jerky motion. | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000565 | Paper_evidence | WBPaper00004275 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; frequently coil. | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference (5) | ||||||||
Method | Insertion_allele |