WormBase Tree Display for Variation: WBVar00143796
expand all nodes | collapse all nodes | view schema
WBVar00143796 | Evidence | Person_evidence | WBPerson11112 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e1170 | |||||
Other_name | F55D12.4a.1:c.47dup | ||||||
F55D12.4b.1:c.47dup | |||||||
CE43454:p.Asp17ArgfsTer11 | |||||||
CE43459:p.Asp17ArgfsTer11 | |||||||
HGVSg | CHROMOSOME_I:g.7903287_7903288insG | ||||||
Sequence_details | SMap | S_parent | Sequence | F55D12 | |||
Flanking_sequences | AGGTGCTGCAAGTCTTGGAAACAGTTCCCC | AGATGCAACAGATTGTGTAGTATGTGGAGA | |||||
Mapping_target | F55D12 | ||||||
Type_of_mutation | Insertion | c | |||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (3) | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects (3) | |||||||
Genetics | Interpolated_map_position | I | 2.38989 | ||||
Mapping_data | In_multi_point | 3515 | |||||
Description | Phenotype | WBPhenotype:0000566 | Paper_evidence | WBPaper00040787 | |||
Curator_confirmed | WBPerson7245 | ||||||
Remark | Fig 3i, animals coil ventrally during reverse locomotion | Paper_evidence | WBPaper00040787 | ||||
Curator_confirmed | WBPerson7245 | ||||||
WBPhenotype:0000655 | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | ||||||
Remark | Figure 1, endogenous IPSCs in the muscle are absent on the ventral side, and increased in frequency on the dorsal side, after ectopic VD synapse remodeling. Note that (Fig S3g-h) endogenous IPSC amplitudes are all normal. | Paper_evidence | WBPaper00040787 | ||||
Curator_confirmed | WBPerson7245 | ||||||
WBPhenotype:0000658 | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | ||||||
Remark | Figure 1, endogenous IPSC frequency in the muscle is absent on the ventral side, and is increased in frequency on the dorsal side. Note that endogenous IPSC amplitudes are normal (Fig S3h) and endogenous EPSCs in the muscle are normal in both rate and amplitude (Fig S1 and S3). | Paper_evidence | WBPaper00040787 | ||||
Curator_confirmed | WBPerson7245 | ||||||
WBPhenotype:0000847 | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | ||||||
Remark | Figure 1, in VD neurons the presynaptic component UNC-57::GFP is decreased in the ventral cord and increased in the dorsal cord after ectopic synapse remodeling. | Paper_evidence | WBPaper00040787 | ||||
Curator_confirmed | WBPerson7245 | ||||||
WBPhenotype:0001276 | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | ||||||
Remark | Figure 2 and S2, a transgene with the hbl-1 promotor (normally not expressed in VD neurons) is expressed in VD neurons. Fig 2c-f for VD10, Fig S2b-d for all VD neurons. Mutating the unc-55 binding sites in the hbl-1 promoter mimics this ectopic expression (Fig 2). | Paper_evidence | WBPaper00040787 | ||||
Curator_confirmed | WBPerson7245 | ||||||
WBPhenotype:0001319 | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | ||||||
Remark | Figure 1, ventral IPSCs in the muscle are eliminated after ectopic VD synapse remodeling. Note that ventral EPSCs in the muscle are normal (Fig S1d-f). | Paper_evidence | WBPaper00040787 | ||||
Curator_confirmed | WBPerson7245 | ||||||
WBPhenotype:0001801 | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | ||||||
Remark | Figure 1, VD neurons inappropriately remodel presynapses from the ventral cord into the dorsal cord (which normally only has postsynapses). Note that before ectopic remodeling, axodendritic polarity is normal (Fig S1g-j). | Paper_evidence | WBPaper00040787 | ||||
Curator_confirmed | WBPerson7245 | ||||||
WBPhenotype:0002232 | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | ||||||
Remark | Figure 1 & S1, VD neurons ectopically remodel synapses from the ventral cord to the dorsal cord. | Paper_evidence | WBPaper00040787 | ||||
Curator_confirmed | WBPerson7245 | ||||||
WBPhenotype:0002262 | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | ||||||
Remark | Fig S1b-c, in the muscle the postsynaptic component UNC-49 GABA(A) receptor is increased adjacent to the dorsal cord | Paper_evidence | WBPaper00040787 | ||||
Curator_confirmed | WBPerson7245 | ||||||
WBPhenotype:0004007 | Paper_evidence | WBPaper00032054 | |||||
Curator_confirmed | WBPerson8772 | ||||||
Remark | males will attempt but are unable to mate successfully. (Data submitted by Ge Shan and Bill Walthall) | Paper_evidence | WBPaper00032054 | ||||
Curator_confirmed | WBPerson8772 | ||||||
Phenotype_not_observed | WBPhenotype:0000625 | Paper_evidence | WBPaper00040787 | ||||
Curator_confirmed | WBPerson7245 | ||||||
Remark | Fig S1 g-j, initial synaptogenesis (before ectopic VD neuron remodeling) properly locates presynaptic components (UNC-57 endophilin) in the ventral side of VD neurons adjacent to postsynaptic components (UNC-49 GABA-A receptor) in the ventral muscle, with normal synapse density | Paper_evidence | WBPaper00040787 | ||||
Curator_confirmed | WBPerson7245 | ||||||
WBPhenotype:0000656 | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | ||||||
Remark | Fig S1d-f, endogenous EPSC rate and amplitude in the muscle are unchanged | Paper_evidence | WBPaper00040787 | ||||
Curator_confirmed | WBPerson7245 | ||||||
WBPhenotype:0001320 | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | ||||||
Remark | Fig S1d-f and S3d, endogenous EPSC amplitude is normal. Fig S3g-h, endogenous IPSC amplitude is normal. | Paper_evidence | WBPaper00040787 | ||||
Curator_confirmed | WBPerson7245 | ||||||
Reference | WBPaper00040787 | ||||||
WBPaper00015216 | |||||||
WBPaper00021904 | |||||||
WBPaper00014720 | |||||||
WBPaper00017613 | |||||||
WBPaper00032054 | |||||||
Method | Insertion_allele |