WormBase Tree Display for Variation: WBVar00143796
expand all nodes | collapse all nodes | view schema
WBVar00143796 | Evidence | Person_evidence | WBPerson11112 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e1170 | |||||
Other_name | F55D12.4a.1:c.47dup | ||||||
F55D12.4b.1:c.47dup | |||||||
CE43454:p.Asp17ArgfsTer11 | |||||||
CE43459:p.Asp17ArgfsTer11 | |||||||
HGVSg | CHROMOSOME_I:g.7903287_7903288insG | ||||||
Sequence_details | SMap | S_parent | Sequence | F55D12 | |||
Flanking_sequences | AGGTGCTGCAAGTCTTGGAAACAGTTCCCC | AGATGCAACAGATTGTGTAGTATGTGGAGA | |||||
Mapping_target | F55D12 | ||||||
Type_of_mutation | Insertion | c | |||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004259 | ||||||
WBStrain00006182 | |||||||
WBStrain00040603 | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects (3) | |||||||
Genetics | Interpolated_map_position | I | 2.38989 | ||||
Mapping_data | In_multi_point | 3515 | |||||
Description | Phenotype (10) | ||||||
Phenotype_not_observed | WBPhenotype:0000625 | Paper_evidence | WBPaper00040787 | ||||
Curator_confirmed | WBPerson7245 | ||||||
Remark | Fig S1 g-j, initial synaptogenesis (before ectopic VD neuron remodeling) properly locates presynaptic components (UNC-57 endophilin) in the ventral side of VD neurons adjacent to postsynaptic components (UNC-49 GABA-A receptor) in the ventral muscle, with normal synapse density | Paper_evidence | WBPaper00040787 | ||||
Curator_confirmed | WBPerson7245 | ||||||
WBPhenotype:0000656 | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | ||||||
Remark | Fig S1d-f, endogenous EPSC rate and amplitude in the muscle are unchanged | Paper_evidence | WBPaper00040787 | ||||
Curator_confirmed | WBPerson7245 | ||||||
WBPhenotype:0001320 | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | ||||||
Remark | Fig S1d-f and S3d, endogenous EPSC amplitude is normal. Fig S3g-h, endogenous IPSC amplitude is normal. | Paper_evidence | WBPaper00040787 | ||||
Curator_confirmed | WBPerson7245 | ||||||
Reference | WBPaper00040787 | ||||||
WBPaper00015216 | |||||||
WBPaper00021904 | |||||||
WBPaper00014720 | |||||||
WBPaper00017613 | |||||||
WBPaper00032054 | |||||||
Method | Insertion_allele |