WormBase Tree Display for Variation: WBVar00143776
expand all nodes | collapse all nodes | view schema
WBVar00143776 | Evidence | Paper_evidence | WBPaper00006502 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | ZK381 | |||||
Flanking_sequences | cagattgttgagcaccgcgagtctgaaatt | ctatagccagccagtggaaggccacgtttc | |||||||
Mapping_target | ZK381 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (84) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001862 | |||||||
Transcript | ZK381.1a.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | ZK381.1a.1:c.46C>T | ||||||||
HGVSp | CE07625:p.Pro16Ser | ||||||||
cDNA_position | 64 | ||||||||
CDS_position | 46 | ||||||||
Protein_position | 16 | ||||||||
Exon_number | 2/6 | ||||||||
Codon_change | Cct/Tct | ||||||||
Amino_acid_change | P/S | ||||||||
Genetics | Interpolated_map_position | IV | 3.26837 | ||||||
Mapping_data | In_multi_point | 109 | |||||||
110 | |||||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00000179 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 1.4% eggs never hatch, yet are refractile; wild type animals produce 0.8% inviable zygotes. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000863 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males exhibit 74.1% wild type fertility. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00000565 | |||||||
WBPaper00000179 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Male self-progeny make up 2.6% population as measured from 4 broods, 1028 total animals. | Paper_evidence | WBPaper00000565 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals segregate 3.5% males compared to 0.3% segregated by wild type animals. | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Self-progeny 3.5% XO male. Difficult to score (ES2) in progeny. | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001583 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals segregate a small percentage (1.1%) of short animals shown to be 3X hermaphrodites (wild type segregates 0.04% 3X herm.). | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001631 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 2% ova are nullo-X. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000143 | Paper_evidence | WBPaper00000565 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | UV sensitivities were measured as % survival based on radiation dose. Alkaline bleach isolated eggs ranging in age from 30-180 minutes were aliquoted to plates to give between 25-300 survivors/plate. The plated eggs were irradiated at different doses at a rate of 1Jm 10X-2/sec. Irradiated animals were protected from light. Survival was scored as the % animals reaching adulthood 4-6 days after irradiation relative to un-irradiated controls. | Paper_evidence | WBPaper00000565 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals have an average brood size of 35329 s.d. (6 broods counted), wild type has average brood size 33034 s.d. (8 broods counted). | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000276 | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | X-ray sensitivities were measured as % survival based on radiation dose. Alkaline bleach isolated eggs ranging in age from 30-180 minutes were aliquoted to plates to give between 25-300 survivors/plate. The plated eggs were irradiated at different doses at a rate of 470 r/min. Survival was scored as the % animals reaching adulthood 4-6 days after irradiation relative to un-irradiated controls. | Paper_evidence | WBPaper00000565 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000517 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are indistinguishable from wild type in terms of behavior. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Both hermaphrodites and males are indistinguishable from wild type in terms of superficial anatomy. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001631 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The sex ratio of cross progeny sired by him males does not significantly differ from 1:1. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00015329 | ||||||||
WBPaper00000565 | |||||||||
WBPaper00016279 | |||||||||
WBPaper00013698 | |||||||||
WBPaper00000179 | |||||||||
WBPaper00011748 | |||||||||
WBPaper00011726 | |||||||||
Method | Substitution_allele |