WormBase Tree Display for Variation: WBVar00143763
expand all nodes | collapse all nodes | view schema
WBVar00143763 | Evidence | Paper_evidence | WBPaper00004136 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1124 | |||||||
Other_name | CE32386:p.Gln2233Ter | ||||||||
F18C12.1.1:c.6697C>T | |||||||||
HGVSg | CHROMOSOME_I:g.8071718G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F18C12 | |||||
Flanking_sequences | ctgataacgggaacaactggatgtggaaaa | aacagcttctgaagcattgcttccagaatg | |||||||
Mapping_target | F18C12 | ||||||||
Type_of_mutation | Substitution | C | T | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004248 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000485 | |||||||
Transcript | F18C12.1.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F18C12.1.1:c.6697C>T | ||||||||
HGVSp | CE32386:p.Gln2233Ter | ||||||||
cDNA_position | 6697 | ||||||||
CDS_position | 6697 | ||||||||
Protein_position | 2233 | ||||||||
Exon_number | 27/49 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000502224 | ||||||||
WBInteraction000520981 | |||||||||
WBInteraction000554845 | |||||||||
Genetics | Interpolated_map_position | I | 2.44242 | ||||||
Mapping_data (3) | |||||||||
Description | Phenotype (31) | ||||||||
Phenotype_not_observed | WBPhenotype:0000067 | Paper_evidence | WBPaper00003582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mutants showed a normal feeding inhibition response when exposed to either cadmium or captan | Paper_evidence | WBPaper00003582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (21) | |||||||||
Method | Substitution_allele |