WormBase Tree Display for Variation: WBVar00143747
expand all nodes | collapse all nodes | view schema
WBVar00143747 | Evidence | Paper_evidence | WBPaper00029148 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1107 | ||||||
Other_name | e1107am | |||||||
CE16260:p.Trp126Ter | ||||||||
LLC1.1a.1:c.377G>A | ||||||||
HGVSg | CHROMOSOME_IV:g.14442280C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | LLC1 | ||||
Flanking_sequences | cgtacgctggaatatttagattcagatttt | gagatttggaaaatgggtcgaagtggttat | ||||||
Mapping_target | LLC1 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002548 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004393 | |||||||
WBStrain00004399 | ||||||||
WBStrain00004498 | ||||||||
WBStrain00004508 | ||||||||
WBStrain00004523 | ||||||||
WBStrain00004529 | ||||||||
WBStrain00004560 | ||||||||
WBStrain00004665 | ||||||||
WBStrain00030550 | ||||||||
WBStrain00030551 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006606 | ||||||
Transcript | LLC1.1a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | LLC1.1a.1:c.377G>A | |||||||
HGVSp | CE16260:p.Trp126Ter | |||||||
cDNA_position | 411 | |||||||
CDS_position | 377 | |||||||
Protein_position | 126 | |||||||
Exon_number | 3/10 | |||||||
Codon_change | tGg/tAg | |||||||
Amino_acid_change | W/* | |||||||
Interactor | WBInteraction000052142 | |||||||
WBInteraction000517253 | ||||||||
WBInteraction000518359 | ||||||||
WBInteraction000518399 | ||||||||
WBInteraction000518400 | ||||||||
WBInteraction000519033 | ||||||||
WBInteraction000519036 | ||||||||
WBInteraction000519042 | ||||||||
WBInteraction000571518 | ||||||||
Genetics | Interpolated_map_position | IV | 12.0984 | |||||
Mapping_data | In_2_point | 318 | ||||||
In_multi_point | 130 | |||||||
131 | ||||||||
762 | ||||||||
1619 | ||||||||
1622 | ||||||||
Description | Phenotype | WBPhenotype:0000038 | Paper_evidence | WBPaper00000178 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000178 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Maternal | ||||||||
WBPhenotype:0000073 | Paper_evidence | WBPaper00000178 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Pseudomales have vestigial bursa structures | Paper_evidence | WBPaper00000178 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000178 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Maternal | ||||||||
WBPhenotype:0001025 | Paper_evidence | WBPaper00000178 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Pseudomales have extra ventral nerve cord processes. Pseudomales also have a set of diagonal muscles (that are normally present only in adult males) and vestigial vulval structures. | Paper_evidence | WBPaper00000178 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000178 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Maternal | ||||||||
WBPhenotype:0001277 | Paper_evidence | WBPaper00000178 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed (2) | ||||||||
Remark (2) | ||||||||
Recessive | Paper_evidence | WBPaper00000178 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Maternal | With_maternal_effect | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES3_Easy_to_score (2) | |||||||
WBPhenotype:0001355 | Paper_evidence | WBPaper00000178 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The gonads of XX pseudomales are large and have two reflexed arms. | Paper_evidence | WBPaper00000178 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000178 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Maternal | ||||||||
WBPhenotype:0001507 | Paper_evidence | WBPaper00049138 | ||||||
Person_evidence | WBPerson18666 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | mutants are tolerant to Cry6Aa protein | Paper_evidence | WBPaper00049138 | |||||
Person_evidence | WBPerson18666 | |||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002606 | Paper_evidence | WBPaper00041673 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Likewise, loss of crt-1, cnx-1, itr-1, clp-1, tra-3, asp-3, or asp-4 partially suppressed HBx-induced cell killing (from 50% to 12-32% PLM death; Fig. 2A), indicating that HBx induces cell death in part through the necrotic pathway." | Paper_evidence | WBPaper00041673 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00041673 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | smIs98 [Pmec-3::GFP; Pmec-7::HBx] | Paper_evidence | WBPaper00041673 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference (14) | ||||||||
Method | Substitution_allele |