WormBase Tree Display for Variation: WBVar00143738
expand all nodes | collapse all nodes | view schema
WBVar00143738 | Evidence | Paper_evidence | WBPaper00003994 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (2) | |||||||||
Sequence_details | SMap | S_parent | Sequence | Y47D3B | |||||
Flanking_sequences | tatgggcttgagttatatttctctaaccct | aaactgaaagaaatattccgaaaatccttg | |||||||
Mapping_target | Y47D3B | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004397 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001077 | |||||||
Transcript | Y47D3B.10.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | ?-89 | ||||||||
CDS_position | ?-88 | ||||||||
Protein_position | ?-30 | ||||||||
Exon_number | 1-2/9 | ||||||||
Genetics | Interpolated_map_position | III | 8.89472 | ||||||
Description | Phenotype | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Homozygous Ram. Males are not Ram at 16C. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations (2) | |||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00001328 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001678 | Paper_evidence | WBPaper00003994 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | There was a significant reduction in the hydroxyproline content of cuticle collagen from dpy-18 (e1096) animals compared with wild-type cuticle extracts. | Paper_evidence | WBPaper00003994 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_not_observed | WBPhenotype:0000648 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ray function was not severely disrupted by the morphological defects as most Ram males mated efficiently | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00001328 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations (2) | |||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00001328 | ||||||||
WBPaper00014010 | |||||||||
WBPaper00015683 | |||||||||
WBPaper00003994 | |||||||||
Method | Deletion_allele |