WormBase Tree Display for Variation: WBVar00143737
expand all nodes | collapse all nodes | view schema
WBVar00143737 | Evidence | Paper_evidence | WBPaper00001553 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | C15F1 | |||||
Flanking_sequences | tctcgaaacattgaaaagatgaagaagtcg | aagaaaatttggacaaagaaaagagtgaag | |||||||
Mapping_target | C15F1 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00001553 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004405 | ||||||||
WBStrain00004576 | |||||||||
WBStrain00004579 | |||||||||
WBStrain00004581 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006605 | |||||||
Transcript | C15F1.3a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C15F1.3a.1:c.3868C>T | ||||||||
HGVSp | CE23546:p.Gln1290Ter | ||||||||
cDNA_position | 3868 | ||||||||
CDS_position | 3868 | ||||||||
Protein_position | 1290 | ||||||||
Exon_number | 23/24 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
C15F1.3c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C15F1.3c.1:c.604C>T | ||||||||
HGVSp | CE43762:p.Gln202Ter | ||||||||
cDNA_position | 604 | ||||||||
CDS_position | 604 | ||||||||
Protein_position | 202 | ||||||||
Exon_number | 3/3 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000052137 | ||||||||
WBInteraction000052144 | |||||||||
WBInteraction000052147 | |||||||||
WBInteraction000052158 | |||||||||
WBInteraction000052159 | |||||||||
WBInteraction000052160 | |||||||||
WBInteraction000052161 | |||||||||
WBInteraction000052162 | |||||||||
WBInteraction000524196 | |||||||||
Genetics | Interpolated_map_position | II | 0.150823 | ||||||
Mapping_data | In_multi_point | 843 | |||||||
1471 | |||||||||
1473 | |||||||||
2311 | |||||||||
Description | Phenotype | WBPhenotype:0000073 | Paper_evidence | WBPaper00000178 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Abnormal bursa morphology in pseudomales . Variable reductions or abnormalities in structures such as the bursal fan, sensory rays and spicules. | Paper_evidence | WBPaper00000178 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000178 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000184 | Paper_evidence | WBPaper00035521 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | tra-2/dypunc XX hermaphrodites were competent for both physiological and checkpoint-activated apoptosis, but no apoptosis was observed in N2 X0 and tra-2/tra-2 XX males under either condition. | Paper_evidence | WBPaper00035521 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00035521 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In tra-2 XX male mutant germ lines, RAD-51 foci progression and abundance mirrored N2 XX hermaphrodite germ lines. | Paper_evidence | WBPaper00035521 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | e1095/+ is Egl hermaphrodite. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Semi_dominant | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000647 | Paper_evidence | WBPaper00000178 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | XX pseudomales do not mate | Paper_evidence | WBPaper00000178 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000178 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000648 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | X0 phenotype wildtype male. X0 male mating always successful (ME3); XX transformed males never successful (ME0). | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Semi_dominant | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001025 | Paper_evidence | WBPaper00000178 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Pseudomales have a variable number of catecholamine cells. Pseudomales also have a set of diagonal muscles (that are normally present only in adult males). | Paper_evidence | WBPaper00000178 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000178 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001277 | Paper_evidence | WBPaper00000178 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed (2) | |||||||||
Remark (2) | |||||||||
Recessive | Paper_evidence | WBPaper00000178 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001355 | Paper_evidence | WBPaper00000178 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Feulgen-stained preparations show that gonads are abnormal in the XX pseudomales | Paper_evidence | WBPaper00000178 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000178 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001824 | Paper_evidence | WBPaper00035521 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Prophase progression timing of tra-2(lf) XX males was similar to N2 X0 males with prophase completed by 20-24 hr; progression of nuclei through each substage was similar to N2 X0 males, although there were fewer labeled nuclei in thetransition zone in tra-2(lf) XX compared to N2 X0 males. | Paper_evidence | WBPaper00035521 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000424 | Paper_evidence | WBPaper00028730 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | nuclei of loss-of-function mutant tra-2 (e1095) and wild-type male were scarcely immunostained with anti-TRA-2 ICD antibody | Paper_evidence | WBPaper00028730 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00028730 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00028730 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00036019 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not differ significantly in the levels of expression of speramtheca and sheath reporter transgenes, fkh-6::GFP and lim-7::GFP. | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (13) | |||||||||
Method | Substitution_allele |