WormBase Tree Display for Variation: WBVar00143653
expand all nodes | collapse all nodes | view schema
WBVar00143653 | Name | Public_name | e979 | ||
---|---|---|---|---|---|
Other_name | CE46852:p.Cys146Tyr | ||||
Y55D5A.5c.1:c.437G>A | |||||
Y55D5A.5a.1:c.437G>A | |||||
CE50204:p.Cys146Tyr | |||||
Y55D5A.5d.1:c.296G>A | |||||
CE50312:p.Cys99Tyr | |||||
CE50158:p.Cys70Tyr | |||||
Y55D5A.5e.1:c.209G>A | |||||
HGVSg | CHROMOSOME_III:g.3017014C>T | ||||
Sequence_details | SMap | S_parent | Sequence | Y55D5A | |
Flanking_sequences | agccgtgtgcctcaatagtcgaaaaacgat | cggcccaatcgatattcgaaataggccgtg | |||
Mapping_target | Y55D5A | ||||
Type_of_mutation | Substitution | g | a | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin (4) | |||||
Affects | Gene | WBGene00000898 | |||
Transcript | Y55D5A.5e.1 (12) | ||||
Y55D5A.5a.1 (12) | |||||
Y55D5A.5c.1 (12) | |||||
Y55D5A.5d.1 (12) | |||||
Interactor | WBInteraction000009107 | ||||
WBInteraction000009108 | |||||
WBInteraction000052470 | |||||
WBInteraction000517272 | |||||
WBInteraction000517275 | |||||
WBInteraction000517276 | |||||
WBInteraction000517281 | |||||
Genetics | Interpolated_map_position | III | -8.03771 | ||
Description (2) | |||||
Reference | WBPaper00031936 | ||||
WBPaper00000214 | |||||
WBPaper00037649 | |||||
WBPaper00031688 | |||||
WBPaper00035504 | |||||
WBPaper00059059 | |||||
Remark | Allele e979 is cited in WBPaper00005310. A subsequent erratum explains that the strain was incorrectly referred to as daf-2(e979) but was infact daf-2(m41). | Curator_confirmed | WBPerson2970 | ||
Method | Substitution_allele |